EMAIL THIS PAGE TO A FRIEND

C11orf34

chromosome 11 open reading frame 34

37 Gene Product Result for
Synonyms: PLET1
Gene ID:
chicken(419791) chromosome 24 open reading frame, human C11orf34
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145024 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718626 Rosetta Predictions human pricing
XM_927535 Rosetta Predictions human pricing
XM_938130 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00425245 predicted 526
2 SASI_Hs02_00425246 predicted 663
3 SASI_Hs02_00425247 predicted 442
4 SASI_Hs02_00425248 predicted 611
5 SASI_Hs02_00425249 predicted 458
6 SASI_Hs02_00425250 predicted 356
7 SASI_Hs02_00425251 predicted 474
8 SASI_Hs02_00425252 predicted 415
9 SASI_Hs02_00425253 predicted 662
10 SASI_Hs02_00425254 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272581 predicted 669
2 SASI_Hs01_00272582 predicted 530
3 SASI_Hs01_00272583 predicted 434
4 SASI_Hs01_00272584 predicted 613
5 SASI_Hs01_00272585 predicted 455
6 SASI_Hs01_00272586 predicted 356
7 SASI_Hs01_00272587 predicted 475
8 SASI_Hs01_00272588 predicted 416
9 SASI_Hs01_00272589 predicted 656
10 SASI_Hs02_00480620 predicted 670
11 SASI_Hs01_00272580 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482938 predicted 531
2 SASI_Hs02_00482939 predicted 671
3 SASI_Hs02_00482940 predicted 439
4 SASI_Hs02_00482941 predicted 615
5 SASI_Hs02_00482942 predicted 461
6 SASI_Hs02_00482943 predicted 359
7 SASI_Hs02_00482944 predicted 471
8 SASI_Hs02_00482945 predicted 414
9 SASI_Hs02_00482946 predicted 665
10 SASI_Hs02_00482947 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145024
C11orf34 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 34
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-465s21c1
Sequence:CCGGCCGTGAATGACAGCGTCTATGCTCGAGCATAGACGCTGTCATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-530s21c1
Sequence:CCGGCTCTGGCAAAGAGCGGATAAACTCGAGTTTATCCGCTCTTTGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-556s21c1
Sequence:CCGGCTACAGCAACTCCACGTATTACTCGAGTAATACGTGGAGTTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145024.1-1080s21c1
Sequence:CCGGAGATGTTCATCTGGATCTTTCCTCGAGGAAAGATCCAGATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-585s21c1
Sequence:CCGGATCAATACATGACGGTCTTAGCTCGAGCTAAGACCGTCATGTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145024
C11orf34 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 34
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-465s21c1
Sequence:CCGGCCGTGAATGACAGCGTCTATGCTCGAGCATAGACGCTGTCATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-530s21c1
Sequence:CCGGCTCTGGCAAAGAGCGGATAAACTCGAGTTTATCCGCTCTTTGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-556s21c1
Sequence:CCGGCTACAGCAACTCCACGTATTACTCGAGTAATACGTGGAGTTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145024.1-1080s21c1
Sequence:CCGGAGATGTTCATCTGGATCTTTCCTCGAGGAAAGATCCAGATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-585s21c1
Sequence:CCGGATCAATACATGACGGTCTTAGCTCGAGCTAAGACCGTCATGTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145024
C11orf34 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 34
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-465s21c1
Sequence:CCGGCCGTGAATGACAGCGTCTATGCTCGAGCATAGACGCTGTCATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-530s21c1
Sequence:CCGGCTCTGGCAAAGAGCGGATAAACTCGAGTTTATCCGCTCTTTGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-556s21c1
Sequence:CCGGCTACAGCAACTCCACGTATTACTCGAGTAATACGTGGAGTTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145024.1-1080s21c1
Sequence:CCGGAGATGTTCATCTGGATCTTTCCTCGAGGAAAGATCCAGATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145024.1-585s21c1
Sequence:CCGGATCAATACATGACGGTCTTAGCTCGAGCTAAGACCGTCATGTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks