EMAIL THIS PAGE TO A FRIEND

C11orf35

chromosome 11 open reading frame 35

22 Gene Product Result for
Species: Human C11orf35(256329)
UniProtKB ID: Q8IXW0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173573 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088028 predicted 1026
2 SASI_Hs01_00088029 predicted 1139
3 SASI_Hs01_00088030 predicted 806
4 SASI_Hs01_00088033 predicted 932
5 SASI_Hs01_00088035 predicted 1010
6 SASI_Hs01_00088036 predicted 1203
7 SASI_Hs01_00088037 predicted 727
8 SASI_Hs02_00368412 predicted 683
9 SASI_Hs02_00368413 predicted 837
10 SASI_Hs02_00368414 predicted 816
11 SASI_Hs01_00088031 predicted 1032
12 SASI_Hs01_00088032 predicted 1027
13 SASI_Hs01_00088034 predicted 1169
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173573
C11orf35 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 35
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-376s21c1
Sequence:CCGGAGCTCCCACAGTCAGGAGAAACTCGAGTTTCTCCTGACTGTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-405s21c1
Sequence:CCGGGAACCAGGTCCAGAAGCTGATCTCGAGATCAGCTTCTGGACCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-1813s21c1
Sequence:CCGGCTCCAGAAAGAACACCGAGTTCTCGAGAACTCGGTGTTCTTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-833s21c1
Sequence:CCGGATTCCGAGCGGCATCACAAGACTCGAGTCTTGTGATGCCGCTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-621s21c1
Sequence:CCGGAGTGACGGCAGAGACTCTGATCTCGAGATCAGAGTCTCTGCCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-1175s21c1
Sequence:CCGGAGAAGTTCGTCCGCATCTTCACTCGAGTGAAGATGCGGACGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-737s21c1
Sequence:CCGGCCAACCTCTTCACCAACATGGCTCGAGCCATGTTGGTGAAGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-1030s21c1
Sequence:CCGGGACTCAGAAGATCTCCAGAAACTCGAGTTTCTGGAGATCTTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173573.1-417s1c1
Sequence:CCGGGAAGCTGATCCAGGAGTTGAACTCGAGTTCAACTCCTGGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173573.1-732s1c1
Sequence:CCGGGTATCCCAACCTCTTCACCAACTCGAGTTGGTGAAGAGGTTGGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173573
C11orf35 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 35
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-376s21c1
Sequence:CCGGAGCTCCCACAGTCAGGAGAAACTCGAGTTTCTCCTGACTGTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-405s21c1
Sequence:CCGGGAACCAGGTCCAGAAGCTGATCTCGAGATCAGCTTCTGGACCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-1813s21c1
Sequence:CCGGCTCCAGAAAGAACACCGAGTTCTCGAGAACTCGGTGTTCTTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-833s21c1
Sequence:CCGGATTCCGAGCGGCATCACAAGACTCGAGTCTTGTGATGCCGCTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-621s21c1
Sequence:CCGGAGTGACGGCAGAGACTCTGATCTCGAGATCAGAGTCTCTGCCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-1175s21c1
Sequence:CCGGAGAAGTTCGTCCGCATCTTCACTCGAGTGAAGATGCGGACGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-737s21c1
Sequence:CCGGCCAACCTCTTCACCAACATGGCTCGAGCCATGTTGGTGAAGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-1030s21c1
Sequence:CCGGGACTCAGAAGATCTCCAGAAACTCGAGTTTCTGGAGATCTTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173573.1-417s1c1
Sequence:CCGGGAAGCTGATCCAGGAGTTGAACTCGAGTTCAACTCCTGGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173573.1-732s1c1
Sequence:CCGGGTATCCCAACCTCTTCACCAACTCGAGTTGGTGAAGAGGTTGGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173573
C11orf35 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 35
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-376s21c1
Sequence:CCGGAGCTCCCACAGTCAGGAGAAACTCGAGTTTCTCCTGACTGTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-405s21c1
Sequence:CCGGGAACCAGGTCCAGAAGCTGATCTCGAGATCAGCTTCTGGACCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-1813s21c1
Sequence:CCGGCTCCAGAAAGAACACCGAGTTCTCGAGAACTCGGTGTTCTTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-833s21c1
Sequence:CCGGATTCCGAGCGGCATCACAAGACTCGAGTCTTGTGATGCCGCTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-621s21c1
Sequence:CCGGAGTGACGGCAGAGACTCTGATCTCGAGATCAGAGTCTCTGCCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-1175s21c1
Sequence:CCGGAGAAGTTCGTCCGCATCTTCACTCGAGTGAAGATGCGGACGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-737s21c1
Sequence:CCGGCCAACCTCTTCACCAACATGGCTCGAGCCATGTTGGTGAAGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173573.1-1030s21c1
Sequence:CCGGGACTCAGAAGATCTCCAGAAACTCGAGTTTCTGGAGATCTTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173573.1-417s1c1
Sequence:CCGGGAAGCTGATCCAGGAGTTGAACTCGAGTTCAACTCCTGGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173573.1-732s1c1
Sequence:CCGGGTATCCCAACCTCTTCACCAACTCGAGTTGGTGAAGAGGTTGGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks