EMAIL THIS PAGE TO A FRIEND

C11orf40

chromosome 11 open reading frame 40

13 Gene Product Result for
Synonyms: NOV1
Species: Human C11orf40(143501)
UniProtKB ID: Q8WZ69
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144663 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144663 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185749 predicted 234
2 SASI_Hs01_00185750 predicted 304
3 SASI_Hs01_00185751 predicted 356
4 SASI_Hs01_00185752 predicted 362
5 SASI_Hs01_00185753 predicted 263
6 SASI_Hs01_00185754 predicted 393
7 SASI_Hs01_00185755 predicted 214
8 SASI_Hs01_00185756 predicted 173
9 SASI_Hs02_00364548 predicted 381
10 SASI_Hs01_00185757 predicted 169
11 SASI_Hs01_00185758 predicted 169
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144663
C11orf40 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 40
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-293s1c1
Sequence:CCGGCTTGCTTTAGGGTACTACCTTCTCGAGAAGGTAGTACCCTAAAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-475s1c1
Sequence:CCGGCAACACTGCAAGTGTTCAATACTCGAGTATTGAACACTTGCAGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-390s1c1
Sequence:CCGGCCAGCTTCTATGTGACTTAATCTCGAGATTAAGTCACATAGAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144663.1-467s1c1
Sequence:CCGGCCAACATGCAACACTGCAAGTCTCGAGACTTGCAGTGTTGCATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-326s1c1
Sequence:CCGGGTGTTTCCAGTGGAATCTCTACTCGAGTAGAGATTCCACTGGAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-453s1c1
Sequence:CCGGGAGCCTTAAAGCTACCAACATCTCGAGATGTTGGTAGCTTTAAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144663.1-174s21c1
Sequence:CCGGCAGAGCCTTTAACTTAGATAACTCGAGTTATCTAAGTTAAAGGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144663.1-519s21c1
Sequence:CCGGATTGGACCGCACTGATTACAACTCGAGTTGTAATCAGTGCGGTCCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144663
C11orf40 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 40
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-293s1c1
Sequence:CCGGCTTGCTTTAGGGTACTACCTTCTCGAGAAGGTAGTACCCTAAAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-475s1c1
Sequence:CCGGCAACACTGCAAGTGTTCAATACTCGAGTATTGAACACTTGCAGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-390s1c1
Sequence:CCGGCCAGCTTCTATGTGACTTAATCTCGAGATTAAGTCACATAGAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144663.1-467s1c1
Sequence:CCGGCCAACATGCAACACTGCAAGTCTCGAGACTTGCAGTGTTGCATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-326s1c1
Sequence:CCGGGTGTTTCCAGTGGAATCTCTACTCGAGTAGAGATTCCACTGGAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-453s1c1
Sequence:CCGGGAGCCTTAAAGCTACCAACATCTCGAGATGTTGGTAGCTTTAAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144663.1-174s21c1
Sequence:CCGGCAGAGCCTTTAACTTAGATAACTCGAGTTATCTAAGTTAAAGGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144663.1-519s21c1
Sequence:CCGGATTGGACCGCACTGATTACAACTCGAGTTGTAATCAGTGCGGTCCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144663
C11orf40 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 40
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-293s1c1
Sequence:CCGGCTTGCTTTAGGGTACTACCTTCTCGAGAAGGTAGTACCCTAAAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-475s1c1
Sequence:CCGGCAACACTGCAAGTGTTCAATACTCGAGTATTGAACACTTGCAGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-390s1c1
Sequence:CCGGCCAGCTTCTATGTGACTTAATCTCGAGATTAAGTCACATAGAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144663.1-467s1c1
Sequence:CCGGCCAACATGCAACACTGCAAGTCTCGAGACTTGCAGTGTTGCATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-326s1c1
Sequence:CCGGGTGTTTCCAGTGGAATCTCTACTCGAGTAGAGATTCCACTGGAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144663.1-453s1c1
Sequence:CCGGGAGCCTTAAAGCTACCAACATCTCGAGATGTTGGTAGCTTTAAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144663.1-174s21c1
Sequence:CCGGCAGAGCCTTTAACTTAGATAACTCGAGTTATCTAAGTTAAAGGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144663.1-519s21c1
Sequence:CCGGATTGGACCGCACTGATTACAACTCGAGTTGTAATCAGTGCGGTCCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)