EMAIL THIS PAGE TO A FRIEND

C11orf42

chromosome 11 open reading frame 42

28 Gene Product Result for
Species: Human C11orf42(160298)
UniProtKB ID: Q8N5U0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173525 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156321 MISSION® esiRNA esiRNA human C11orf42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173525 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182172 predicted 402
2 SASI_Hs01_00182173 predicted 897
3 SASI_Hs01_00182174 predicted 364
4 SASI_Hs01_00182175 predicted 713
5 SASI_Hs01_00182176 predicted 624
6 SASI_Hs01_00182177 predicted 362
7 SASI_Hs01_00182178 predicted 404
8 SASI_Hs01_00182179 predicted 327
9 SASI_Hs01_00182180 predicted 472
10 SASI_Hs01_00182181 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173525
C11orf42 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 42
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-143s1c1
Sequence:CCGGCCAATGCAGTAGCAGTACCTTCTCGAGAAGGTACTGCTACTGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-855s1c1
Sequence:CCGGCAAACCCACCAGATTCTCCTACTCGAGTAGGAGAATCTGGTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-905s1c1
Sequence:CCGGCCCAGATACTGTCAGAGAACTCTCGAGAGTTCTCTGACAGTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-441s1c1
Sequence:CCGGCAAGAAGGTTGCCTTCCTGTTCTCGAGAACAGGAAGGCAACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-764s1c1
Sequence:CCGGCATCAGCATCTGCTGATACAACTCGAGTTGTATCAGCAGATGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173525
C11orf42 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 42
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-143s1c1
Sequence:CCGGCCAATGCAGTAGCAGTACCTTCTCGAGAAGGTACTGCTACTGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-855s1c1
Sequence:CCGGCAAACCCACCAGATTCTCCTACTCGAGTAGGAGAATCTGGTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-905s1c1
Sequence:CCGGCCCAGATACTGTCAGAGAACTCTCGAGAGTTCTCTGACAGTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-441s1c1
Sequence:CCGGCAAGAAGGTTGCCTTCCTGTTCTCGAGAACAGGAAGGCAACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-764s1c1
Sequence:CCGGCATCAGCATCTGCTGATACAACTCGAGTTGTATCAGCAGATGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173525
C11orf42 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 42
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-143s1c1
Sequence:CCGGCCAATGCAGTAGCAGTACCTTCTCGAGAAGGTACTGCTACTGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-855s1c1
Sequence:CCGGCAAACCCACCAGATTCTCCTACTCGAGTAGGAGAATCTGGTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-905s1c1
Sequence:CCGGCCCAGATACTGTCAGAGAACTCTCGAGAGTTCTCTGACAGTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-441s1c1
Sequence:CCGGCAAGAAGGTTGCCTTCCTGTTCTCGAGAACAGGAAGGCAACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173525.1-764s1c1
Sequence:CCGGCATCAGCATCTGCTGATACAACTCGAGTTGTATCAGCAGATGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks