EMAIL THIS PAGE TO A FRIEND

C11orf44

chromosome 11 open reading frame 44

40 Gene Product Result for
Species: Human C11orf44(283171)
UniProtKB ID: Q8N8P7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173580 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173580 Rosetta Predictions human pricing
XR_039976 Rosetta Predictions human pricing
XR_039977 Rosetta Predictions human pricing
XR_039978 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032239 predicted 740
2 SASI_Hs01_00032240 predicted 684
3 SASI_Hs01_00032241 predicted 574
4 SASI_Hs01_00032242 predicted 716
5 SASI_Hs01_00032243 predicted 551
6 SASI_Hs01_00032244 predicted 158
7 SASI_Hs01_00032245 predicted 690
8 SASI_Hs01_00032246 predicted 831
9 SASI_Hs01_00032247 predicted 185
10 SASI_Hs01_00032248 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514791 predicted 153
2 SASI_Hs02_00514792 predicted 197
3 SASI_Hs02_00514793 predicted 172
4 SASI_Hs02_00514794 predicted 152
5 SASI_Hs02_00514795 predicted 172
6 SASI_Hs02_00514796 predicted 145
7 SASI_Hs02_00514797 predicted 87
8 SASI_Hs02_00514798 predicted 87
9 SASI_Hs02_00514799 predicted 81
10 SASI_Hs02_00514800 predicted 167
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514801 predicted 148
2 SASI_Hs02_00514802 predicted 200
3 SASI_Hs02_00514803 predicted 164
4 SASI_Hs02_00514804 predicted 154
5 SASI_Hs02_00514805 predicted 176
6 SASI_Hs02_00514806 predicted 142
7 SASI_Hs02_00514807 predicted 91
8 SASI_Hs02_00514808 predicted 83
9 SASI_Hs02_00514809 predicted 90
10 SASI_Hs02_00514810 predicted 161
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514811 predicted 149
2 SASI_Hs02_00514812 predicted 195
3 SASI_Hs02_00514813 predicted 168
4 SASI_Hs02_00514814 predicted 152
5 SASI_Hs02_00514815 predicted 173
6 SASI_Hs02_00514816 predicted 144
7 SASI_Hs02_00514817 predicted 87
8 SASI_Hs02_00514818 predicted 89
9 SASI_Hs02_00514819 predicted 87
10 SASI_Hs02_00514820 predicted 160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173580
C11orf44 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 44
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167033    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173580.1-3038s1c1
Sequence:CCGGCCACTTACTAATAACTGCTTACTCGAGTAAGCAGTTATTAGTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173580.1-569s1c1
Sequence:CCGGCCTTAATGTTAGACACTGTTTCTCGAGAAACAGTGTCTAACATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173580.1-203s1c1
Sequence:CCGGGAGTCTGGCTTATTTCCAGCACTCGAGTGCTGGAAATAAGCCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173580.1-340s1c1
Sequence:CCGGGAGACAGAGTCTTGCTCTGTTCTCGAGAACAGAGCAAGACTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173580.1-177s1c1
Sequence:CCGGGATCTGGTCATGACCACATCACTCGAGTGATGTGGTCATGACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173580
C11orf44 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 44
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167033    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173580.1-3038s1c1
Sequence:CCGGCCACTTACTAATAACTGCTTACTCGAGTAAGCAGTTATTAGTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173580.1-569s1c1
Sequence:CCGGCCTTAATGTTAGACACTGTTTCTCGAGAAACAGTGTCTAACATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173580.1-203s1c1
Sequence:CCGGGAGTCTGGCTTATTTCCAGCACTCGAGTGCTGGAAATAAGCCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173580.1-340s1c1
Sequence:CCGGGAGACAGAGTCTTGCTCTGTTCTCGAGAACAGAGCAAGACTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173580.1-177s1c1
Sequence:CCGGGATCTGGTCATGACCACATCACTCGAGTGATGTGGTCATGACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173580
C11orf44 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 44
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167033    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173580.1-3038s1c1
Sequence:CCGGCCACTTACTAATAACTGCTTACTCGAGTAAGCAGTTATTAGTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173580.1-569s1c1
Sequence:CCGGCCTTAATGTTAGACACTGTTTCTCGAGAAACAGTGTCTAACATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173580.1-203s1c1
Sequence:CCGGGAGTCTGGCTTATTTCCAGCACTCGAGTGCTGGAAATAAGCCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173580.1-340s1c1
Sequence:CCGGGAGACAGAGTCTTGCTCTGTTCTCGAGAACAGAGCAAGACTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173580.1-177s1c1
Sequence:CCGGGATCTGGTCATGACCACATCACTCGAGTGATGTGGTCATGACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks