EMAIL THIS PAGE TO A FRIEND

C11orf45

chromosome 11 open reading frame 45

Species: Human C11orf45(219833)
UniProtKB ID: Q8TAV5, B2RAD0
Gene ID:
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145013 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020561 MISSION® esiRNA esiRNA human C11orf45 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145013 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077032 predicted 686
2 SASI_Hs01_00077033 predicted 801
3 SASI_Hs01_00077034 predicted 789
4 SASI_Hs01_00077035 predicted 604
5 SASI_Hs01_00077036 predicted 601
6 SASI_Hs01_00077037 predicted 931
7 SASI_Hs01_00077039 predicted 775
8 SASI_Hs01_00077040 predicted 550
9 SASI_Hs02_00364861 predicted 528
10 SASI_Hs02_00364862 predicted 893
11 SASI_Hs01_00077038 predicted 470
12 SASI_Hs01_00077041 predicted 491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145013
VALIDATED
C11orf45 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 45
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145013.1-481s1c1
Sequence:CCGGCCACAAACATTACCTGTCAGTCTCGAGACTGACAGGTAATGTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_145013.1-362s1c1
Sequence:CCGGCACCTCCTCACTCTGGAATTTCTCGAGAAATTCCAGAGTGAGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145013.1-546s1c1
Sequence:CCGGTCAATCTGCAAGGCCCATGATCTCGAGATCATGGGCCTTGCAGATTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145013.1-3099s1c1
Sequence:CCGGGCCCGATTCAAGGTATGGAATCTCGAGATTCCATACCTTGAATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145013.1-405s1c1
Sequence:CCGGGCCATAGTAACCAGAACCTGTCTCGAGACAGGTTCTGGTTACTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145013.1-288s21c1
Sequence:CCGGCTGATGCCTAGTCCCAGAATCCTCGAGGATTCTGGGACTAGGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145013.1-935s21c1
Sequence:CCGGCGATGTAATGGATGCTGATTACTCGAGTAATCAGCATCCATTACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145013
VALIDATED
C11orf45 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 45
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145013.1-481s1c1
Sequence:CCGGCCACAAACATTACCTGTCAGTCTCGAGACTGACAGGTAATGTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_145013.1-362s1c1
Sequence:CCGGCACCTCCTCACTCTGGAATTTCTCGAGAAATTCCAGAGTGAGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145013.1-546s1c1
Sequence:CCGGTCAATCTGCAAGGCCCATGATCTCGAGATCATGGGCCTTGCAGATTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145013.1-3099s1c1
Sequence:CCGGGCCCGATTCAAGGTATGGAATCTCGAGATTCCATACCTTGAATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145013.1-405s1c1
Sequence:CCGGGCCATAGTAACCAGAACCTGTCTCGAGACAGGTTCTGGTTACTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145013.1-288s21c1
Sequence:CCGGCTGATGCCTAGTCCCAGAATCCTCGAGGATTCTGGGACTAGGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145013.1-935s21c1
Sequence:CCGGCGATGTAATGGATGCTGATTACTCGAGTAATCAGCATCCATTACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145013
VALIDATED
C11orf45 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 45
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145013.1-481s1c1
Sequence:CCGGCCACAAACATTACCTGTCAGTCTCGAGACTGACAGGTAATGTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_145013.1-362s1c1
Sequence:CCGGCACCTCCTCACTCTGGAATTTCTCGAGAAATTCCAGAGTGAGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145013.1-546s1c1
Sequence:CCGGTCAATCTGCAAGGCCCATGATCTCGAGATCATGGGCCTTGCAGATTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145013.1-3099s1c1
Sequence:CCGGGCCCGATTCAAGGTATGGAATCTCGAGATTCCATACCTTGAATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145013.1-405s1c1
Sequence:CCGGGCCATAGTAACCAGAACCTGTCTCGAGACAGGTTCTGGTTACTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145013.1-288s21c1
Sequence:CCGGCTGATGCCTAGTCCCAGAATCCTCGAGGATTCTGGGACTAGGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145013.1-935s21c1
Sequence:CCGGCGATGTAATGGATGCTGATTACTCGAGTAATCAGCATCCATTACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks