EMAIL THIS PAGE TO A FRIEND

C11orf48

chromosome 11 open reading frame 48

37 Gene Product Result for
Species: Human C11orf48(79081)
UniProtKB ID: Q9BQE6, Q96NA4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024099 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120591 MISSION® esiRNA esiRNA human C11orf48 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024099 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070652 predicted 240
2 SASI_Hs01_00070653 predicted 381
3 SASI_Hs01_00070654 predicted 899
4 SASI_Hs01_00070655 predicted 1004
5 SASI_Hs02_00356579 predicted 341
6 SASI_Hs01_00070656 predicted 1065
7 SASI_Hs02_00356580 predicted 500
8 SASI_Hs01_00070657 predicted 378
9 SASI_Hs01_00070658 predicted 692
10 SASI_Hs01_00070661 predicted 836
11 SASI_Hs01_00070659 predicted 550
12 SASI_Hs01_00070660 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024099
VALIDATED
C11orf48 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 48
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024099.3-1184s21c1
Sequence:CCGGCAGATTTCCTCCTACCTAATGCTCGAGCATTAGGTAGGAGGAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024099.3-704s21c1
Sequence:CCGGGAAGTGGCTTTGTGGAATATTCTCGAGAATATTCCACAAAGCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024099.3-549s21c1
Sequence:CCGGGGACCCTAGAAGTCCTTTAAGCTCGAGCTTAAAGGACTTCTAGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024099.3-380s21c1
Sequence:CCGGAGTCCCATCTGCCGTCTATTGCTCGAGCAATAGACGGCAGATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024099.3-726s21c1
Sequence:CCGGCCATCTCCTGCCTCCTAATAGCTCGAGCTATTAGGAGGCAGGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024099.2-1183s1c1
Sequence:CCGGCCAGATTTCCTCCTACCTAATCTCGAGATTAGGTAGGAGGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024099.2-757s1c1
Sequence:CCGGGCTGAAGAAGAAGCTGTTCAACTCGAGTTGAACAGCTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024099.2-247s1c1
Sequence:CCGGGATGGGCTTTGGACTAGAAATCTCGAGATTTCTAGTCCAAAGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024099.2-546s1c1
Sequence:CCGGACAGGACCCTAGAAGTCCTTTCTCGAGAAAGGACTTCTAGGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024099
VALIDATED
C11orf48 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 48
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024099.3-1184s21c1
Sequence:CCGGCAGATTTCCTCCTACCTAATGCTCGAGCATTAGGTAGGAGGAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024099.3-704s21c1
Sequence:CCGGGAAGTGGCTTTGTGGAATATTCTCGAGAATATTCCACAAAGCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024099.3-549s21c1
Sequence:CCGGGGACCCTAGAAGTCCTTTAAGCTCGAGCTTAAAGGACTTCTAGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024099.3-380s21c1
Sequence:CCGGAGTCCCATCTGCCGTCTATTGCTCGAGCAATAGACGGCAGATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024099.3-726s21c1
Sequence:CCGGCCATCTCCTGCCTCCTAATAGCTCGAGCTATTAGGAGGCAGGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024099.2-1183s1c1
Sequence:CCGGCCAGATTTCCTCCTACCTAATCTCGAGATTAGGTAGGAGGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024099.2-757s1c1
Sequence:CCGGGCTGAAGAAGAAGCTGTTCAACTCGAGTTGAACAGCTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024099.2-247s1c1
Sequence:CCGGGATGGGCTTTGGACTAGAAATCTCGAGATTTCTAGTCCAAAGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024099.2-546s1c1
Sequence:CCGGACAGGACCCTAGAAGTCCTTTCTCGAGAAAGGACTTCTAGGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024099
VALIDATED
C11orf48 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 48
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024099.3-1184s21c1
Sequence:CCGGCAGATTTCCTCCTACCTAATGCTCGAGCATTAGGTAGGAGGAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024099.3-704s21c1
Sequence:CCGGGAAGTGGCTTTGTGGAATATTCTCGAGAATATTCCACAAAGCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024099.3-549s21c1
Sequence:CCGGGGACCCTAGAAGTCCTTTAAGCTCGAGCTTAAAGGACTTCTAGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024099.3-380s21c1
Sequence:CCGGAGTCCCATCTGCCGTCTATTGCTCGAGCAATAGACGGCAGATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024099.3-726s21c1
Sequence:CCGGCCATCTCCTGCCTCCTAATAGCTCGAGCTATTAGGAGGCAGGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024099.2-1183s1c1
Sequence:CCGGCCAGATTTCCTCCTACCTAATCTCGAGATTAGGTAGGAGGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024099.2-757s1c1
Sequence:CCGGGCTGAAGAAGAAGCTGTTCAACTCGAGTTGAACAGCTTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024099.2-247s1c1
Sequence:CCGGGATGGGCTTTGGACTAGAAATCTCGAGATTTCTAGTCCAAAGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024099.2-546s1c1
Sequence:CCGGACAGGACCCTAGAAGTCCTTTCTCGAGAAAGGACTTCTAGGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks