EMAIL THIS PAGE TO A FRIEND

C11orf49

chromosome 11 open reading frame 49

88 Gene Product Result for
Gene ID:
chicken(423188) chromosome 5 open reading frame, human C11orf49
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024113 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004201 MISSION® esiRNA esiRNA targeting human C11orf49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003676 Rosetta Predictions human pricing
NM_001003677 Rosetta Predictions human pricing
NM_001003678 Rosetta Predictions human pricing
NM_024113 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139493 predicted 204
2 SASI_Hs01_00139494 predicted 467
3 SASI_Hs01_00139495 predicted 354
4 SASI_Hs01_00139496 predicted 466
5 SASI_Hs01_00139497 predicted 223
6 SASI_Hs01_00139498 predicted 382
7 SASI_Hs02_00304306 predicted 376
8 SASI_Hs01_00139500 predicted 510
9 SASI_Hs01_00139501 predicted 411
10 SASI_Hs01_00139502 predicted 257
11 SASI_Hs01_00139499 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111934 predicted 204
2 SASI_Hs01_00111935 predicted 459
3 SASI_Hs01_00111936 predicted 357
4 SASI_Hs01_00111937 predicted 464
5 SASI_Hs01_00111938 predicted 225
6 SASI_Hs01_00111939 predicted 381
7 SASI_Hs02_00304307 predicted 377
8 SASI_Hs01_00111941 predicted 512
9 SASI_Hs01_00111942 predicted 415
10 SASI_Hs01_00111943 predicted 264
11 SASI_Hs01_00111940 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078820 predicted 206
2 SASI_Hs01_00078821 predicted 460
3 SASI_Hs01_00078822 predicted 358
4 SASI_Hs01_00078823 predicted 465
5 SASI_Hs01_00078824 predicted 229
6 SASI_Hs01_00078825 predicted 375
7 SASI_Hs02_00304308 predicted 381
8 SASI_Hs01_00078827 predicted 507
9 SASI_Hs01_00078828 predicted 416
10 SASI_Hs01_00078829 predicted 262
11 SASI_Hs01_00078826 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180357 predicted 202
2 SASI_Hs01_00180358 predicted 467
3 SASI_Hs01_00180359 predicted 351
4 SASI_Hs01_00180360 predicted 463
5 SASI_Hs01_00180361 predicted 225
6 SASI_Hs01_00180362 predicted 380
7 SASI_Hs02_00356608 predicted 378
8 SASI_Hs01_00180364 predicted 514
9 SASI_Hs01_00180365 predicted 411
10 SASI_Hs01_00180366 predicted 259
11 SASI_Hs01_00180363 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024113
VALIDATED
C11orf49 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 49
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024113.2-789s1c1
Sequence:CCGGCTCAAAGCACCGTGGAATCAACTCGAGTTGATTCCACGGTGCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-361s1c1
Sequence:CCGGGAATATCACTGTTTGCTGCAACTCGAGTTGCAGCAAACAGTGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024113.2-353s1c1
Sequence:CCGGCCATGAAAGAATATCACTGTTCTCGAGAACAGTGATATTCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-169s1c1
Sequence:CCGGGAAGATATTAGCCAATATGGACTCGAGTCCATATTGGCTAATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-343s1c1
Sequence:CCGGGATTTGCTGACCATGAAAGAACTCGAGTTCTTTCATGGTCAGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-378s1c1
Sequence:CCGGGCAATTACTGTGTCCTGATTTCTCGAGAAATCAGGACACAGTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024113.2-194s1c1
Sequence:CCGGCCAGGTTCTTCACTGAATATTCTCGAGAATATTCAGTGAAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-859s1c1
Sequence:CCGGGCAATGGATGAAGAGCTGGAACTCGAGTTCCAGCTCTTCATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-756s1c1
Sequence:CCGGGAGACTGACCTTCTATGGATTCTCGAGAATCCATAGAAGGTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-450s1c1
Sequence:CCGGCATGGACTGCTTGATGTCTTTCTCGAGAAAGACATCAAGCAGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-762s1c1
Sequence:CCGGGACCTTCTATGGATTCCTCATCTCGAGATGAGGAATCCATAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-223s1c1
Sequence:CCGGGTATGCCAGGGAACACACATTCTCGAGAATGTGTGTTCCCTGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-746s1c1
Sequence:CCGGGCAATGTTCAGAGACTGACCTCTCGAGAGGTCAGTCTCTGAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024113.3-493s21c1
Sequence:CCGGCATGGACTGCTTGATGTCTTTCTCGAGAAAGACATCAAGCAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024113.3-266s21c1
Sequence:CCGGGTATGCCAGGGAACACACATTCTCGAGAATGTGTGTTCCCTGGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024113.3-421s21c1
Sequence:CCGGGCAATTACTGTGTCCTGATTTCTCGAGAAATCAGGACACAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024113.3-789s21c1
Sequence:CCGGGCAATGTTCAGAGACTGACCTCTCGAGAGGTCAGTCTCTGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024113.3-386s21c1
Sequence:CCGGGATTTGCTGACCATGAAAGAACTCGAGTTCTTTCATGGTCAGCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024113
VALIDATED
C11orf49 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 49
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024113.2-789s1c1
Sequence:CCGGCTCAAAGCACCGTGGAATCAACTCGAGTTGATTCCACGGTGCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-361s1c1
Sequence:CCGGGAATATCACTGTTTGCTGCAACTCGAGTTGCAGCAAACAGTGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024113.2-353s1c1
Sequence:CCGGCCATGAAAGAATATCACTGTTCTCGAGAACAGTGATATTCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-169s1c1
Sequence:CCGGGAAGATATTAGCCAATATGGACTCGAGTCCATATTGGCTAATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-343s1c1
Sequence:CCGGGATTTGCTGACCATGAAAGAACTCGAGTTCTTTCATGGTCAGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-378s1c1
Sequence:CCGGGCAATTACTGTGTCCTGATTTCTCGAGAAATCAGGACACAGTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024113.2-194s1c1
Sequence:CCGGCCAGGTTCTTCACTGAATATTCTCGAGAATATTCAGTGAAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-859s1c1
Sequence:CCGGGCAATGGATGAAGAGCTGGAACTCGAGTTCCAGCTCTTCATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-756s1c1
Sequence:CCGGGAGACTGACCTTCTATGGATTCTCGAGAATCCATAGAAGGTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-450s1c1
Sequence:CCGGCATGGACTGCTTGATGTCTTTCTCGAGAAAGACATCAAGCAGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-762s1c1
Sequence:CCGGGACCTTCTATGGATTCCTCATCTCGAGATGAGGAATCCATAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-223s1c1
Sequence:CCGGGTATGCCAGGGAACACACATTCTCGAGAATGTGTGTTCCCTGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-746s1c1
Sequence:CCGGGCAATGTTCAGAGACTGACCTCTCGAGAGGTCAGTCTCTGAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024113.3-493s21c1
Sequence:CCGGCATGGACTGCTTGATGTCTTTCTCGAGAAAGACATCAAGCAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024113.3-266s21c1
Sequence:CCGGGTATGCCAGGGAACACACATTCTCGAGAATGTGTGTTCCCTGGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024113.3-421s21c1
Sequence:CCGGGCAATTACTGTGTCCTGATTTCTCGAGAAATCAGGACACAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024113.3-789s21c1
Sequence:CCGGGCAATGTTCAGAGACTGACCTCTCGAGAGGTCAGTCTCTGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024113.3-386s21c1
Sequence:CCGGGATTTGCTGACCATGAAAGAACTCGAGTTCTTTCATGGTCAGCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024113
VALIDATED
C11orf49 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 49
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024113.2-789s1c1
Sequence:CCGGCTCAAAGCACCGTGGAATCAACTCGAGTTGATTCCACGGTGCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-361s1c1
Sequence:CCGGGAATATCACTGTTTGCTGCAACTCGAGTTGCAGCAAACAGTGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024113.2-353s1c1
Sequence:CCGGCCATGAAAGAATATCACTGTTCTCGAGAACAGTGATATTCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-169s1c1
Sequence:CCGGGAAGATATTAGCCAATATGGACTCGAGTCCATATTGGCTAATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-343s1c1
Sequence:CCGGGATTTGCTGACCATGAAAGAACTCGAGTTCTTTCATGGTCAGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-378s1c1
Sequence:CCGGGCAATTACTGTGTCCTGATTTCTCGAGAAATCAGGACACAGTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024113.2-194s1c1
Sequence:CCGGCCAGGTTCTTCACTGAATATTCTCGAGAATATTCAGTGAAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-859s1c1
Sequence:CCGGGCAATGGATGAAGAGCTGGAACTCGAGTTCCAGCTCTTCATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-756s1c1
Sequence:CCGGGAGACTGACCTTCTATGGATTCTCGAGAATCCATAGAAGGTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-450s1c1
Sequence:CCGGCATGGACTGCTTGATGTCTTTCTCGAGAAAGACATCAAGCAGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-762s1c1
Sequence:CCGGGACCTTCTATGGATTCCTCATCTCGAGATGAGGAATCCATAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-223s1c1
Sequence:CCGGGTATGCCAGGGAACACACATTCTCGAGAATGTGTGTTCCCTGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024113.2-746s1c1
Sequence:CCGGGCAATGTTCAGAGACTGACCTCTCGAGAGGTCAGTCTCTGAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024113.3-493s21c1
Sequence:CCGGCATGGACTGCTTGATGTCTTTCTCGAGAAAGACATCAAGCAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024113.3-266s21c1
Sequence:CCGGGTATGCCAGGGAACACACATTCTCGAGAATGTGTGTTCCCTGGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024113.3-421s21c1
Sequence:CCGGGCAATTACTGTGTCCTGATTTCTCGAGAAATCAGGACACAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024113.3-789s21c1
Sequence:CCGGGCAATGTTCAGAGACTGACCTCTCGAGAGGTCAGTCTCTGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024113.3-386s21c1
Sequence:CCGGGATTTGCTGACCATGAAAGAACTCGAGTTCTTTCATGGTCAGCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks