EMAIL THIS PAGE TO A FRIEND

C11orf52

chromosome 11 open reading frame 52

UniProtKB ID: Q96A22
Gene ID:
chicken(770939) chromosome 24 open reading frame, human C11orf52
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080659 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144951 MISSION® esiRNA esiRNA human C11orf52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080659 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204648 predicted 632
2 SASI_Hs01_00204649 predicted 368
3 SASI_Hs01_00204651 predicted 599
4 SASI_Hs01_00204652 predicted 820
5 SASI_Hs01_00204653 predicted 665
6 SASI_Hs02_00362419 predicted 228
7 SASI_Hs01_00204654 predicted 312
8 SASI_Hs01_00204655 predicted 303
9 SASI_Hs01_00204656 predicted 822
10 SASI_Hs01_00204657 predicted 740
11 SASI_Hs01_00204650 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080659
C11orf52 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 52
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080659.2-599s21c1
Sequence:CCGGGGAATTGTGGGCGTCCCATTTCTCGAGAAATGGGACGCCCACAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080659.2-480s21c1
Sequence:CCGGGAAGGCCCAGTCCATCGTTAACTCGAGTTAACGATGGACTGGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080659.1-605s1c1
Sequence:CCGGCCACTGTTAGGTTGGAGTTAACTCGAGTTAACTCCAACCTAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080659.1-282s1c1
Sequence:CCGGCAACTTACATTATGCTGACATCTCGAGATGTCAGCATAATGTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080659.1-135s1c1
Sequence:CCGGCCAAACAAGACGGACACTGAACTCGAGTTCAGTGTCCGTCTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080659.1-781s1c1
Sequence:CCGGGCTGATCTTGTTGGACTTTAACTCGAGTTAAAGTCCAACAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080659.1-334s1c1
Sequence:CCGGGTGAAACACGTGCATTTAGAACTCGAGTTCTAAATGCACGTGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080659.1-211s1c1
Sequence:CCGGCATACGTATGAACGGGTGTTACTCGAGTAACACCCGTTCATACGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080659
C11orf52 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 52
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080659.2-599s21c1
Sequence:CCGGGGAATTGTGGGCGTCCCATTTCTCGAGAAATGGGACGCCCACAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080659.2-480s21c1
Sequence:CCGGGAAGGCCCAGTCCATCGTTAACTCGAGTTAACGATGGACTGGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080659.1-605s1c1
Sequence:CCGGCCACTGTTAGGTTGGAGTTAACTCGAGTTAACTCCAACCTAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080659.1-282s1c1
Sequence:CCGGCAACTTACATTATGCTGACATCTCGAGATGTCAGCATAATGTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080659.1-135s1c1
Sequence:CCGGCCAAACAAGACGGACACTGAACTCGAGTTCAGTGTCCGTCTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080659.1-781s1c1
Sequence:CCGGGCTGATCTTGTTGGACTTTAACTCGAGTTAAAGTCCAACAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080659.1-334s1c1
Sequence:CCGGGTGAAACACGTGCATTTAGAACTCGAGTTCTAAATGCACGTGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080659.1-211s1c1
Sequence:CCGGCATACGTATGAACGGGTGTTACTCGAGTAACACCCGTTCATACGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080659
C11orf52 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 52
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080659.2-599s21c1
Sequence:CCGGGGAATTGTGGGCGTCCCATTTCTCGAGAAATGGGACGCCCACAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080659.2-480s21c1
Sequence:CCGGGAAGGCCCAGTCCATCGTTAACTCGAGTTAACGATGGACTGGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080659.1-605s1c1
Sequence:CCGGCCACTGTTAGGTTGGAGTTAACTCGAGTTAACTCCAACCTAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080659.1-282s1c1
Sequence:CCGGCAACTTACATTATGCTGACATCTCGAGATGTCAGCATAATGTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080659.1-135s1c1
Sequence:CCGGCCAAACAAGACGGACACTGAACTCGAGTTCAGTGTCCGTCTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080659.1-781s1c1
Sequence:CCGGGCTGATCTTGTTGGACTTTAACTCGAGTTAAAGTCCAACAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080659.1-334s1c1
Sequence:CCGGGTGAAACACGTGCATTTAGAACTCGAGTTCTAAATGCACGTGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080659.1-211s1c1
Sequence:CCGGCATACGTATGAACGGGTGTTACTCGAGTAACACCCGTTCATACGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks