EMAIL THIS PAGE TO A FRIEND

C11orf53

chromosome 11 open reading frame 53

20 Gene Product Result for
Species: Human C11orf53(341032)
UniProtKB ID: Q8IXP5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198498 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198498 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011758 predicted 436
2 SASI_Hs01_00011759 predicted 436
3 SASI_Hs02_00372066 predicted 702
4 SASI_Hs01_00011761 predicted 205
5 SASI_Hs01_00011762 predicted 195
6 SASI_Hs01_00011764 predicted 800
7 SASI_Hs01_00011765 predicted 200
8 SASI_Hs01_00011766 predicted 542
9 SASI_Hs01_00011767 predicted 619
10 SASI_Hs02_00372067 predicted 619
11 SASI_Hs01_00011760 predicted 213
12 SASI_Hs01_00011763 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198498
C11orf53 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 53
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-236s1c1
Sequence:CCGGCAAATGACGTCTACACCTCCACTCGAGTGGAGGTGTAGACGTCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-833s1c1
Sequence:CCGGCATATGAATGCCGCAGAGCTTCTCGAGAAGCTCTGCGGCATTCATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-702s1c1
Sequence:CCGGCCCTTTCATGACGGTGTCAAACTCGAGTTTGACACCGTCATGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-198s1c1
Sequence:CCGGCTTATCTGACTCAGACTTCCACTCGAGTGGAAGTCTGAGTCAGATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-194s1c1
Sequence:CCGGCTTTCTTATCTGACTCAGACTCTCGAGAGTCTGAGTCAGATAAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-802s1c1
Sequence:CCGGGTGAAAGAAGATGGGAGTATTCTCGAGAATACTCCCATCTTCTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-180s1c1
Sequence:CCGGCGGTGTCAGAAGATCTTTCTTCTCGAGAAGAAAGATCTTCTGACACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-205s1c1
Sequence:CCGGGACTCAGACTTCCACAACAGTCTCGAGACTGTTGTGGAAGTCTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198498.1-891s21c1
Sequence:CCGGTAACTTGAGGTGTATTCCAAACTCGAGTTTGGAATACACCTCAAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198498
C11orf53 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 53
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-236s1c1
Sequence:CCGGCAAATGACGTCTACACCTCCACTCGAGTGGAGGTGTAGACGTCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-833s1c1
Sequence:CCGGCATATGAATGCCGCAGAGCTTCTCGAGAAGCTCTGCGGCATTCATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-702s1c1
Sequence:CCGGCCCTTTCATGACGGTGTCAAACTCGAGTTTGACACCGTCATGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-198s1c1
Sequence:CCGGCTTATCTGACTCAGACTTCCACTCGAGTGGAAGTCTGAGTCAGATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-194s1c1
Sequence:CCGGCTTTCTTATCTGACTCAGACTCTCGAGAGTCTGAGTCAGATAAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-802s1c1
Sequence:CCGGGTGAAAGAAGATGGGAGTATTCTCGAGAATACTCCCATCTTCTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-180s1c1
Sequence:CCGGCGGTGTCAGAAGATCTTTCTTCTCGAGAAGAAAGATCTTCTGACACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-205s1c1
Sequence:CCGGGACTCAGACTTCCACAACAGTCTCGAGACTGTTGTGGAAGTCTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198498.1-891s21c1
Sequence:CCGGTAACTTGAGGTGTATTCCAAACTCGAGTTTGGAATACACCTCAAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198498
C11orf53 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 53
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-236s1c1
Sequence:CCGGCAAATGACGTCTACACCTCCACTCGAGTGGAGGTGTAGACGTCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-833s1c1
Sequence:CCGGCATATGAATGCCGCAGAGCTTCTCGAGAAGCTCTGCGGCATTCATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-702s1c1
Sequence:CCGGCCCTTTCATGACGGTGTCAAACTCGAGTTTGACACCGTCATGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-198s1c1
Sequence:CCGGCTTATCTGACTCAGACTTCCACTCGAGTGGAAGTCTGAGTCAGATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-194s1c1
Sequence:CCGGCTTTCTTATCTGACTCAGACTCTCGAGAGTCTGAGTCAGATAAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-802s1c1
Sequence:CCGGGTGAAAGAAGATGGGAGTATTCTCGAGAATACTCCCATCTTCTTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-180s1c1
Sequence:CCGGCGGTGTCAGAAGATCTTTCTTCTCGAGAAGAAAGATCTTCTGACACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198498.1-205s1c1
Sequence:CCGGGACTCAGACTTCCACAACAGTCTCGAGACTGTTGTGGAAGTCTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198498.1-891s21c1
Sequence:CCGGTAACTTGAGGTGTATTCCAAACTCGAGTTTGGAATACACCTCAAGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)