EMAIL THIS PAGE TO A FRIEND

C11orf54

chromosome 11 open reading frame 54

26 Gene Product Result for
Synonyms: PTD012
Species: Human C11orf54(28970)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014039 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014039 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187736 predicted 745
2 SASI_Hs01_00187738 predicted 774
3 SASI_Hs01_00187739 predicted 778
4 SASI_Hs01_00187740 predicted 632
5 SASI_Hs01_00187741 predicted 653
6 SASI_Hs02_00345030 predicted 786
7 SASI_Hs01_00187742 predicted 634
8 SASI_Hs01_00187743 predicted 651
9 SASI_Hs01_00187744 predicted 657
10 SASI_Hs01_00187745 predicted 657
11 SASI_Hs01_00187737 predicted 667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014039
VALIDATED
C11orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 54
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-814s21c1
Sequence:CCGGCAGAGACCCAGGGTTTGATTTCTCGAGAAATCAAACCCTGGGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-318s21c1
Sequence:CCGGATTTGACTAAGGAACCCTTTACTCGAGTAAAGGGTTCCTTAGTCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014039.2-1448s21c1
Sequence:CCGGATCAGGAATCATGCAATTATTCTCGAGAATAATTGCATGATTCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014039.2-1244s21c1
Sequence:CCGGCTCACTACTTAAATCCCATTTCTCGAGAAATGGGATTTAAGTAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-728s21c1
Sequence:CCGGCCCTTGAACTCTGATGAAGAACTCGAGTTCTTCATCAGAGTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-578s21c1
Sequence:CCGGGGAAGTTACTTTGCCCATGTGCTCGAGCACATGGGCAAAGTAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-244s21c1
Sequence:CCGGGCTTGCTGGAGTTATGCAGAACTCGAGTTCTGCATAACTCCAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014039.2-938s1c1
Sequence:CCGGGCAGAGTTTCTCTATCGCATTCTCGAGAATGCGATAGAGAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-317s1c1
Sequence:CCGGGATTTGACTAAGGAACCCTTTCTCGAGAAAGGGTTCCTTAGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014039.2-976s1c1
Sequence:CCGGGCATTCAATTGGGCGAGATTACTCGAGTAATCTCGCCCAATTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-902s1c1
Sequence:CCGGCCAGATATAGTGGAATATCTTCTCGAGAAGATATTCCACTATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-395s1c1
Sequence:CCGGCCTTACTTATTGCCTCTTGTACTCGAGTACAAGAGGCAATAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014039.2-1413s1c1
Sequence:CCGGGCGAAATCAGTCATGTTTATACTCGAGTATAAACATGACTGATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-872s1c1
Sequence:CCGGGAAGGTGGACACTACCATTATCTCGAGATAATGGTAGTGTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014039
VALIDATED
C11orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 54
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-814s21c1
Sequence:CCGGCAGAGACCCAGGGTTTGATTTCTCGAGAAATCAAACCCTGGGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-318s21c1
Sequence:CCGGATTTGACTAAGGAACCCTTTACTCGAGTAAAGGGTTCCTTAGTCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014039.2-1448s21c1
Sequence:CCGGATCAGGAATCATGCAATTATTCTCGAGAATAATTGCATGATTCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014039.2-1244s21c1
Sequence:CCGGCTCACTACTTAAATCCCATTTCTCGAGAAATGGGATTTAAGTAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-728s21c1
Sequence:CCGGCCCTTGAACTCTGATGAAGAACTCGAGTTCTTCATCAGAGTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-578s21c1
Sequence:CCGGGGAAGTTACTTTGCCCATGTGCTCGAGCACATGGGCAAAGTAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-244s21c1
Sequence:CCGGGCTTGCTGGAGTTATGCAGAACTCGAGTTCTGCATAACTCCAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014039.2-938s1c1
Sequence:CCGGGCAGAGTTTCTCTATCGCATTCTCGAGAATGCGATAGAGAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-317s1c1
Sequence:CCGGGATTTGACTAAGGAACCCTTTCTCGAGAAAGGGTTCCTTAGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014039.2-976s1c1
Sequence:CCGGGCATTCAATTGGGCGAGATTACTCGAGTAATCTCGCCCAATTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-902s1c1
Sequence:CCGGCCAGATATAGTGGAATATCTTCTCGAGAAGATATTCCACTATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-395s1c1
Sequence:CCGGCCTTACTTATTGCCTCTTGTACTCGAGTACAAGAGGCAATAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014039.2-1413s1c1
Sequence:CCGGGCGAAATCAGTCATGTTTATACTCGAGTATAAACATGACTGATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-872s1c1
Sequence:CCGGGAAGGTGGACACTACCATTATCTCGAGATAATGGTAGTGTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014039
VALIDATED
C11orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 54
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-814s21c1
Sequence:CCGGCAGAGACCCAGGGTTTGATTTCTCGAGAAATCAAACCCTGGGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-318s21c1
Sequence:CCGGATTTGACTAAGGAACCCTTTACTCGAGTAAAGGGTTCCTTAGTCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014039.2-1448s21c1
Sequence:CCGGATCAGGAATCATGCAATTATTCTCGAGAATAATTGCATGATTCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014039.2-1244s21c1
Sequence:CCGGCTCACTACTTAAATCCCATTTCTCGAGAAATGGGATTTAAGTAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-728s21c1
Sequence:CCGGCCCTTGAACTCTGATGAAGAACTCGAGTTCTTCATCAGAGTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-578s21c1
Sequence:CCGGGGAAGTTACTTTGCCCATGTGCTCGAGCACATGGGCAAAGTAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014039.2-244s21c1
Sequence:CCGGGCTTGCTGGAGTTATGCAGAACTCGAGTTCTGCATAACTCCAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014039.2-938s1c1
Sequence:CCGGGCAGAGTTTCTCTATCGCATTCTCGAGAATGCGATAGAGAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-317s1c1
Sequence:CCGGGATTTGACTAAGGAACCCTTTCTCGAGAAAGGGTTCCTTAGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014039.2-976s1c1
Sequence:CCGGGCATTCAATTGGGCGAGATTACTCGAGTAATCTCGCCCAATTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-902s1c1
Sequence:CCGGCCAGATATAGTGGAATATCTTCTCGAGAAGATATTCCACTATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-395s1c1
Sequence:CCGGCCTTACTTATTGCCTCTTGTACTCGAGTACAAGAGGCAATAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014039.2-1413s1c1
Sequence:CCGGGCGAAATCAGTCATGTTTATACTCGAGTATAAACATGACTGATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014039.2-872s1c1
Sequence:CCGGGAAGGTGGACACTACCATTATCTCGAGATAATGGTAGTGTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks