EMAIL THIS PAGE TO A FRIEND

C11orf57

chromosome 11 open reading frame 57

172 Gene Product Result for
Species: Human C11orf57(55216)
UniProtKB ID: Q6ZUT1, Q5RL41, Q6IN53, Q7Z357, Q8N2T3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018195 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068591 MISSION® esiRNA esiRNA human C11orf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001082969 Rosetta Predictions human pricing
NM_001082970 Rosetta Predictions human pricing
NM_018195 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316792 predicted 1475
2 SASI_Hs02_00316793 predicted 474
3 SASI_Hs02_00316794 predicted 342
4 SASI_Hs02_00316795 predicted 492
5 SASI_Hs02_00316796 predicted 789
6 SASI_Hs02_00316797 predicted 466
7 SASI_Hs02_00316798 predicted 965
8 SASI_Hs02_00316799 predicted 650
9 SASI_Hs02_00316800 predicted 386
10 SASI_Hs02_00316801 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316802 predicted 2028
2 SASI_Hs02_00316803 predicted 1046
3 SASI_Hs02_00316804 predicted 1344
4 SASI_Hs02_00316805 predicted 1522
5 SASI_Hs02_00316806 predicted 1205
6 SASI_Hs02_00316807 predicted 1064
7 SASI_Hs02_00316808 predicted 1588
8 SASI_Hs02_00316809 predicted 1373
9 SASI_Hs02_00316810 predicted 1468
10 SASI_Hs02_00316811 predicted 1595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089611 predicted 2030
2 SASI_Hs01_00089613 predicted 1035
3 SASI_Hs01_00089616 predicted 1351
4 SASI_Hs01_00089617 predicted 1518
5 SASI_Hs01_00089618 predicted 1208
6 SASI_Hs01_00089619 predicted 1068
7 SASI_Hs01_00089620 predicted 1587
8 SASI_Hs02_00351475 predicted 1369
9 SASI_Hs02_00351476 predicted 1465
10 SASI_Hs02_00351477 predicted 1598
11 SASI_Hs01_00089612 predicted 949
12 SASI_Hs01_00089614 predicted 906
13 SASI_Hs01_00089615 predicted 1559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018195
C11orf57 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 57
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1521s1c1
Sequence:CCGGGCTACAGATGAAAGGTCTGCTCTCGAGAGCAGACCTTTCATCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018195.2-3224s1c1
Sequence:CCGGGCATTGTTTCTGTGCCCTGAACTCGAGTTCAGGGCACAGAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1332s1c1
Sequence:CCGGCCTGCTTTATTCTTAGAGGCACTCGAGTGCCTCTAAGAATAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1064s1c1
Sequence:CCGGGCAAGATATTACCAACGGGAACTCGAGTTCCCGTTGGTAATATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1335s1c1
Sequence:CCGGGCTTTATTCTTAGAGGCAGAACTCGAGTTCTGCCTCTAAGAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018195.2-2441s1c1
Sequence:CCGGCCCTGAAACTAAGTTGAATTACTCGAGTAATTCAACTTAGTTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018195.2-2071s1c1
Sequence:CCGGCGGTTTACTTAATCAGGACATCTCGAGATGTCCTGATTAAGTAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1490s1c1
Sequence:CCGGGAGGACAAACAAACGCACAAACTCGAGTTTGTGCGTTTGTTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1097s1c1
Sequence:CCGGCCAGGTAAAGTCATCTACCCACTCGAGTGGGTAGATGACTTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018195
C11orf57 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 57
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1521s1c1
Sequence:CCGGGCTACAGATGAAAGGTCTGCTCTCGAGAGCAGACCTTTCATCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018195.2-3224s1c1
Sequence:CCGGGCATTGTTTCTGTGCCCTGAACTCGAGTTCAGGGCACAGAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1332s1c1
Sequence:CCGGCCTGCTTTATTCTTAGAGGCACTCGAGTGCCTCTAAGAATAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1064s1c1
Sequence:CCGGGCAAGATATTACCAACGGGAACTCGAGTTCCCGTTGGTAATATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1335s1c1
Sequence:CCGGGCTTTATTCTTAGAGGCAGAACTCGAGTTCTGCCTCTAAGAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018195.2-2441s1c1
Sequence:CCGGCCCTGAAACTAAGTTGAATTACTCGAGTAATTCAACTTAGTTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018195.2-2071s1c1
Sequence:CCGGCGGTTTACTTAATCAGGACATCTCGAGATGTCCTGATTAAGTAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1490s1c1
Sequence:CCGGGAGGACAAACAAACGCACAAACTCGAGTTTGTGCGTTTGTTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1097s1c1
Sequence:CCGGCCAGGTAAAGTCATCTACCCACTCGAGTGGGTAGATGACTTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018195
C11orf57 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 57
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1521s1c1
Sequence:CCGGGCTACAGATGAAAGGTCTGCTCTCGAGAGCAGACCTTTCATCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018195.2-3224s1c1
Sequence:CCGGGCATTGTTTCTGTGCCCTGAACTCGAGTTCAGGGCACAGAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1332s1c1
Sequence:CCGGCCTGCTTTATTCTTAGAGGCACTCGAGTGCCTCTAAGAATAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1064s1c1
Sequence:CCGGGCAAGATATTACCAACGGGAACTCGAGTTCCCGTTGGTAATATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1335s1c1
Sequence:CCGGGCTTTATTCTTAGAGGCAGAACTCGAGTTCTGCCTCTAAGAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018195.2-2441s1c1
Sequence:CCGGCCCTGAAACTAAGTTGAATTACTCGAGTAATTCAACTTAGTTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018195.2-2071s1c1
Sequence:CCGGCGGTTTACTTAATCAGGACATCTCGAGATGTCCTGATTAAGTAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1490s1c1
Sequence:CCGGGAGGACAAACAAACGCACAAACTCGAGTTTGTGCGTTTGTTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018195.2-1097s1c1
Sequence:CCGGCCAGGTAAAGTCATCTACCCACTCGAGTGGGTAGATGACTTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks