EMAIL THIS PAGE TO A FRIEND

C11orf58

chromosome 11 open reading frame 58

71 Gene Product Result for
Synonyms: IMAGE145052 SMAP
Species: Human C11orf58(10944)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014267 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014267 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050900 predicted 293
2 SASI_Hs01_00050901 predicted 539
3 SASI_Hs01_00050902 predicted 443
4 SASI_Hs01_00050903 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014267
VALIDATED
C11orf58 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 58
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014267.3-410s1c1
Sequence:CCGGCAGGAAGATATCGGCGACATTCTCGAGAATGTCGCCGATATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-271s1c1
Sequence:CCGGGCAGGAAAGAAAGAACATACTCTCGAGAGTATGTTCTTTCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-1114s1c1
Sequence:CCGGGCTGCCAGTCACAATCTAAATCTCGAGATTTAGATTGTGACTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014267.3-530s1c1
Sequence:CCGGCAGATGATTCTGAAAGCGATTCTCGAGAATCGCTTTCAGAATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-819s1c1
Sequence:CCGGGCTTTCAAATGCCATGGGTTACTCGAGTAACCCATGGCATTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-499s1c1
Sequence:CCGGGACGATGATGATTCACCTGATCTCGAGATCAGGTGAATCATCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-1160s21c1
Sequence:CCGGGCTGCCAGTCACAATCTAAATCTCGAGATTTAGATTGTGACTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-865s21c1
Sequence:CCGGGCTTTCAAATGCCATGGGTTACTCGAGTAACCCATGGCATTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-545s21c1
Sequence:CCGGGACGATGATGATTCACCTGATCTCGAGATCAGGTGAATCATCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-317s21c1
Sequence:CCGGGCAGGAAAGAAAGAACATACTCTCGAGAGTATGTTCTTTCTTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014267
VALIDATED
C11orf58 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 58
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014267.3-410s1c1
Sequence:CCGGCAGGAAGATATCGGCGACATTCTCGAGAATGTCGCCGATATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-271s1c1
Sequence:CCGGGCAGGAAAGAAAGAACATACTCTCGAGAGTATGTTCTTTCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-1114s1c1
Sequence:CCGGGCTGCCAGTCACAATCTAAATCTCGAGATTTAGATTGTGACTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014267.3-530s1c1
Sequence:CCGGCAGATGATTCTGAAAGCGATTCTCGAGAATCGCTTTCAGAATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-819s1c1
Sequence:CCGGGCTTTCAAATGCCATGGGTTACTCGAGTAACCCATGGCATTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-499s1c1
Sequence:CCGGGACGATGATGATTCACCTGATCTCGAGATCAGGTGAATCATCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-1160s21c1
Sequence:CCGGGCTGCCAGTCACAATCTAAATCTCGAGATTTAGATTGTGACTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-865s21c1
Sequence:CCGGGCTTTCAAATGCCATGGGTTACTCGAGTAACCCATGGCATTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-545s21c1
Sequence:CCGGGACGATGATGATTCACCTGATCTCGAGATCAGGTGAATCATCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-317s21c1
Sequence:CCGGGCAGGAAAGAAAGAACATACTCTCGAGAGTATGTTCTTTCTTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014267
VALIDATED
C11orf58 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 58
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014267.3-410s1c1
Sequence:CCGGCAGGAAGATATCGGCGACATTCTCGAGAATGTCGCCGATATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-271s1c1
Sequence:CCGGGCAGGAAAGAAAGAACATACTCTCGAGAGTATGTTCTTTCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-1114s1c1
Sequence:CCGGGCTGCCAGTCACAATCTAAATCTCGAGATTTAGATTGTGACTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014267.3-530s1c1
Sequence:CCGGCAGATGATTCTGAAAGCGATTCTCGAGAATCGCTTTCAGAATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-819s1c1
Sequence:CCGGGCTTTCAAATGCCATGGGTTACTCGAGTAACCCATGGCATTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014267.3-499s1c1
Sequence:CCGGGACGATGATGATTCACCTGATCTCGAGATCAGGTGAATCATCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-1160s21c1
Sequence:CCGGGCTGCCAGTCACAATCTAAATCTCGAGATTTAGATTGTGACTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-865s21c1
Sequence:CCGGGCTTTCAAATGCCATGGGTTACTCGAGTAACCCATGGCATTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-545s21c1
Sequence:CCGGGACGATGATGATTCACCTGATCTCGAGATCAGGTGAATCATCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014267.5-317s21c1
Sequence:CCGGGCAGGAAAGAAAGAACATACTCTCGAGAGTATGTTCTTTCTTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks