EMAIL THIS PAGE TO A FRIEND

C11orf63

chromosome 11 open reading frame 63

40 Gene Product Result for
Species: Human C11orf63(79864)
UniProtKB ID: Q6NUN7, A8K6G0, Q96GB5, Q9H5D6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024806 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158321 MISSION® esiRNA esiRNA human C11orf63 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024806 Rosetta Predictions human pricing
NM_199124 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064400 predicted 578
2 SASI_Hs01_00064401 predicted 444
3 SASI_Hs01_00064402 predicted 845
4 SASI_Hs01_00064403 predicted 643
5 SASI_Hs01_00064404 predicted 630
6 SASI_Hs01_00064405 predicted 412
7 SASI_Hs01_00064406 predicted 847
8 SASI_Hs01_00064407 predicted 434
9 SASI_Hs01_00064408 predicted 585
10 SASI_Hs01_00064409 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247374 predicted 579
2 SASI_Hs01_00247375 predicted 444
3 SASI_Hs01_00247376 predicted 842
4 SASI_Hs01_00247377 predicted 640
5 SASI_Hs01_00247378 predicted 638
6 SASI_Hs01_00247379 predicted 411
7 SASI_Hs01_00247380 predicted 851
8 SASI_Hs01_00247381 predicted 432
9 SASI_Hs01_00247382 predicted 582
10 SASI_Hs01_00247383 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024806
VALIDATED
C11orf63 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 63
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-341s21c1
Sequence:CCGGCTGTCCTTCATACCAACTTAACTCGAGTTAAGTTGGTATGAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-1829s21c1
Sequence:CCGGCTCAGTTTGTTTATCACATAACTCGAGTTATGTGATAAACAAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-2613s21c1
Sequence:CCGGCAAAGTCCTTCACATCGTATACTCGAGTATACGATGTGAAGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-1180s21c1
Sequence:CCGGGTAACAGACAAGACGTCTATTCTCGAGAATAGACGTCTTGTCTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024806.2-1036s1c1
Sequence:CCGGCGGCGAAGGAAATCCAAACAACTCGAGTTGTTTGGATTTCCTTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024806.2-2108s1c1
Sequence:CCGGCCCAACTCAGTTCAGAGAGAACTCGAGTTCTCTCTGAACTGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024806.2-2473s1c1
Sequence:CCGGCCATCAAATCTGACTCATCAACTCGAGTTGATGAGTCAGATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024806.2-2080s1c1
Sequence:CCGGCCTATACTGTCAAGGGTAGAACTCGAGTTCTACCCTTGACAGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024806.2-2713s1c1
Sequence:CCGGGTTGAGAGTAATGGCCTATTACTCGAGTAATAGGCCATTACTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024806.2-449s1c1
Sequence:CCGGCGCAAGAGATTATGTGCCATTCTCGAGAATGGCACATAATCTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024806
VALIDATED
C11orf63 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 63
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-341s21c1
Sequence:CCGGCTGTCCTTCATACCAACTTAACTCGAGTTAAGTTGGTATGAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-1829s21c1
Sequence:CCGGCTCAGTTTGTTTATCACATAACTCGAGTTATGTGATAAACAAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-2613s21c1
Sequence:CCGGCAAAGTCCTTCACATCGTATACTCGAGTATACGATGTGAAGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-1180s21c1
Sequence:CCGGGTAACAGACAAGACGTCTATTCTCGAGAATAGACGTCTTGTCTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024806.2-1036s1c1
Sequence:CCGGCGGCGAAGGAAATCCAAACAACTCGAGTTGTTTGGATTTCCTTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024806.2-2108s1c1
Sequence:CCGGCCCAACTCAGTTCAGAGAGAACTCGAGTTCTCTCTGAACTGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024806.2-2473s1c1
Sequence:CCGGCCATCAAATCTGACTCATCAACTCGAGTTGATGAGTCAGATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024806.2-2080s1c1
Sequence:CCGGCCTATACTGTCAAGGGTAGAACTCGAGTTCTACCCTTGACAGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024806.2-2713s1c1
Sequence:CCGGGTTGAGAGTAATGGCCTATTACTCGAGTAATAGGCCATTACTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024806.2-449s1c1
Sequence:CCGGCGCAAGAGATTATGTGCCATTCTCGAGAATGGCACATAATCTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024806
VALIDATED
C11orf63 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 63
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-341s21c1
Sequence:CCGGCTGTCCTTCATACCAACTTAACTCGAGTTAAGTTGGTATGAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-1829s21c1
Sequence:CCGGCTCAGTTTGTTTATCACATAACTCGAGTTATGTGATAAACAAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-2613s21c1
Sequence:CCGGCAAAGTCCTTCACATCGTATACTCGAGTATACGATGTGAAGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024806.2-1180s21c1
Sequence:CCGGGTAACAGACAAGACGTCTATTCTCGAGAATAGACGTCTTGTCTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024806.2-1036s1c1
Sequence:CCGGCGGCGAAGGAAATCCAAACAACTCGAGTTGTTTGGATTTCCTTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024806.2-2108s1c1
Sequence:CCGGCCCAACTCAGTTCAGAGAGAACTCGAGTTCTCTCTGAACTGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024806.2-2473s1c1
Sequence:CCGGCCATCAAATCTGACTCATCAACTCGAGTTGATGAGTCAGATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024806.2-2080s1c1
Sequence:CCGGCCTATACTGTCAAGGGTAGAACTCGAGTTCTACCCTTGACAGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024806.2-2713s1c1
Sequence:CCGGGTTGAGAGTAATGGCCTATTACTCGAGTAATAGGCCATTACTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024806.2-449s1c1
Sequence:CCGGCGCAAGAGATTATGTGCCATTCTCGAGAATGGCACATAATCTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks