EMAIL THIS PAGE TO A FRIEND

C11orf68

chromosome 11 open reading frame 68

83 Gene Product Result for
Synonyms: BLES03 P5326
Species: Human C11orf68(83638)
UniProtKB ID: Q9H3H3, J3KQG9, Q9BT13
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031450 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145151 MISSION® esiRNA esiRNA human C11orf68 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031450 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187476 predicted 819
2 SASI_Hs01_00187477 predicted 748
3 SASI_Hs01_00187478 predicted 869
4 SASI_Hs01_00187479 predicted 382
5 SASI_Hs01_00187480 predicted 1023
6 SASI_Hs01_00187481 predicted 1010
7 SASI_Hs01_00187482 predicted 1285
8 SASI_Hs01_00187483 predicted 878
9 SASI_Hs01_00187484 predicted 695
10 SASI_Hs01_00187485 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031450
VALIDATED
C11orf68 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 68
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-874s21c1
Sequence:CCGGTGCTTGACCGTGCCAACAACGCTCGAGCGTTGTTGGCACGGTCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-656s21c1
Sequence:CCGGGCGCCAGGTCATCTGTGTTTACTCGAGTAAACACAGATGACCTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-725s21c1
Sequence:CCGGCATCCGTGCAGCGGGCATTAACTCGAGTTAATGCCCGCTGCACGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-822s21c1
Sequence:CCGGACTCTCTATGAGAGCCGTTTCCTCGAGGAAACGGCTCTCATAGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-702s21c1
Sequence:CCGGGGTGTACTGGAGGCGGATTCACTCGAGTGAATCCGCCTCCAGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-741s21c1
Sequence:CCGGATTAAGTGCCTGCTCACCTACCTCGAGGTAGGTGAGCAGGCACTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031450.2-1138s1c1
Sequence:CCGGCCTTTGTAATGCTGCTCCTCTCTCGAGAGAGGAGCAGCATTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031450.2-1052s1c1
Sequence:CCGGCTTGAACTTCTGCCCTCTGTTCTCGAGAACAGAGGGCAGAAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031450.2-663s1c1
Sequence:CCGGGTCATCTGTGTTTACACGGACCTCGAGGTCCGTGTAAACACAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031450.2-1369s1c1
Sequence:CCGGGAGGGTAGTTGTGCCTACTTACTCGAGTAAGTAGGCACAACTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031450.2-887s1c1
Sequence:CCGGCAACAACGTGGAACTGACCTACTCGAGTAGGTCAGTTCCACGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031450.2-1202s1c1
Sequence:CCGGGAGACTTCTTGGAACGCTCATCTCGAGATGAGCGTTCCAAGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031450
VALIDATED
C11orf68 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 68
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-874s21c1
Sequence:CCGGTGCTTGACCGTGCCAACAACGCTCGAGCGTTGTTGGCACGGTCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-656s21c1
Sequence:CCGGGCGCCAGGTCATCTGTGTTTACTCGAGTAAACACAGATGACCTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-725s21c1
Sequence:CCGGCATCCGTGCAGCGGGCATTAACTCGAGTTAATGCCCGCTGCACGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-822s21c1
Sequence:CCGGACTCTCTATGAGAGCCGTTTCCTCGAGGAAACGGCTCTCATAGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-702s21c1
Sequence:CCGGGGTGTACTGGAGGCGGATTCACTCGAGTGAATCCGCCTCCAGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-741s21c1
Sequence:CCGGATTAAGTGCCTGCTCACCTACCTCGAGGTAGGTGAGCAGGCACTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031450.2-1138s1c1
Sequence:CCGGCCTTTGTAATGCTGCTCCTCTCTCGAGAGAGGAGCAGCATTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031450.2-1052s1c1
Sequence:CCGGCTTGAACTTCTGCCCTCTGTTCTCGAGAACAGAGGGCAGAAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031450.2-663s1c1
Sequence:CCGGGTCATCTGTGTTTACACGGACCTCGAGGTCCGTGTAAACACAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031450.2-1369s1c1
Sequence:CCGGGAGGGTAGTTGTGCCTACTTACTCGAGTAAGTAGGCACAACTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031450.2-887s1c1
Sequence:CCGGCAACAACGTGGAACTGACCTACTCGAGTAGGTCAGTTCCACGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031450.2-1202s1c1
Sequence:CCGGGAGACTTCTTGGAACGCTCATCTCGAGATGAGCGTTCCAAGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031450
VALIDATED
C11orf68 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 68
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-874s21c1
Sequence:CCGGTGCTTGACCGTGCCAACAACGCTCGAGCGTTGTTGGCACGGTCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-656s21c1
Sequence:CCGGGCGCCAGGTCATCTGTGTTTACTCGAGTAAACACAGATGACCTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-725s21c1
Sequence:CCGGCATCCGTGCAGCGGGCATTAACTCGAGTTAATGCCCGCTGCACGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-822s21c1
Sequence:CCGGACTCTCTATGAGAGCCGTTTCCTCGAGGAAACGGCTCTCATAGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-702s21c1
Sequence:CCGGGGTGTACTGGAGGCGGATTCACTCGAGTGAATCCGCCTCCAGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031450.3-741s21c1
Sequence:CCGGATTAAGTGCCTGCTCACCTACCTCGAGGTAGGTGAGCAGGCACTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031450.2-1138s1c1
Sequence:CCGGCCTTTGTAATGCTGCTCCTCTCTCGAGAGAGGAGCAGCATTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031450.2-1052s1c1
Sequence:CCGGCTTGAACTTCTGCCCTCTGTTCTCGAGAACAGAGGGCAGAAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031450.2-663s1c1
Sequence:CCGGGTCATCTGTGTTTACACGGACCTCGAGGTCCGTGTAAACACAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031450.2-1369s1c1
Sequence:CCGGGAGGGTAGTTGTGCCTACTTACTCGAGTAAGTAGGCACAACTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031450.2-887s1c1
Sequence:CCGGCAACAACGTGGAACTGACCTACTCGAGTAGGTCAGTTCCACGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031450.2-1202s1c1
Sequence:CCGGGAGACTTCTTGGAACGCTCATCTCGAGATGAGCGTTCCAAGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks