EMAIL THIS PAGE TO A FRIEND

C11orf70

chromosome 11 open reading frame 70

23 Gene Product Result for
Species: Human C11orf70(85016)
UniProtKB ID: Q9BRQ4, E9PJU1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032930 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034951 MISSION® esiRNA esiRNA human C11orf70 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032930 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031878 predicted 410
2 SASI_Hs01_00031879 predicted 405
3 SASI_Hs01_00031881 predicted 394
4 SASI_Hs01_00031882 predicted 380
5 SASI_Hs01_00031883 predicted 811
6 SASI_Hs01_00031884 predicted 770
7 SASI_Hs01_00031885 predicted 807
8 SASI_Hs01_00031886 predicted 571
9 SASI_Hs01_00031887 predicted 612
10 SASI_Hs02_00360543 predicted 921
11 SASI_Hs01_00031880 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032930
C11orf70 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 70
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-721s1c1
Sequence:CCGGGATAGAGAAGAGTTCCTGTTTCTCGAGAAACAGGAACTCTTCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-787s1c1
Sequence:CCGGGAGGATGTGATTAGCCCATATCTCGAGATATGGGCTAATCACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-656s1c1
Sequence:CCGGCTGATGAGTTACGAAGAGTTTCTCGAGAAACTCTTCGTAACTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032930.1-598s1c1
Sequence:CCGGCGAGACAGTGGACATATTGTTCTCGAGAACAATATGTCCACTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-714s1c1
Sequence:CCGGCCAACCAGATAGAGAAGAGTTCTCGAGAACTCTTCTCTATCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-442s1c1
Sequence:CCGGGACCCAAATGTTATTCCCAATCTCGAGATTGGGAATAACATTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032930.1-772s1c1
Sequence:CCGGGCCCTTTGTCAATATGAGGATCTCGAGATCCTCATATTGACAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032930.1-800s1c1
Sequence:CCGGGCCCATATCTGGAAACAACAACTCGAGTTGTTGTTTCCAGATATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-846s21c1
Sequence:CCGGTGTTCGAAAGAATCCTCAAACCTCGAGGTTTGAGGATTCTTTCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-547s21c1
Sequence:CCGGACACAGCTTTCAATGTCATTTCTCGAGAAATGACATTGAAAGCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-595s21c1
Sequence:CCGGGTACGAGACAGTGGACATATTCTCGAGAATATGTCCACTGTCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-408s21c1
Sequence:CCGGTCGGAAGGATGATTTCGTTATCTCGAGATAACGAAATCATCCTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032930
C11orf70 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 70
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-721s1c1
Sequence:CCGGGATAGAGAAGAGTTCCTGTTTCTCGAGAAACAGGAACTCTTCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-787s1c1
Sequence:CCGGGAGGATGTGATTAGCCCATATCTCGAGATATGGGCTAATCACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-656s1c1
Sequence:CCGGCTGATGAGTTACGAAGAGTTTCTCGAGAAACTCTTCGTAACTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032930.1-598s1c1
Sequence:CCGGCGAGACAGTGGACATATTGTTCTCGAGAACAATATGTCCACTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-714s1c1
Sequence:CCGGCCAACCAGATAGAGAAGAGTTCTCGAGAACTCTTCTCTATCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-442s1c1
Sequence:CCGGGACCCAAATGTTATTCCCAATCTCGAGATTGGGAATAACATTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032930.1-772s1c1
Sequence:CCGGGCCCTTTGTCAATATGAGGATCTCGAGATCCTCATATTGACAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032930.1-800s1c1
Sequence:CCGGGCCCATATCTGGAAACAACAACTCGAGTTGTTGTTTCCAGATATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-846s21c1
Sequence:CCGGTGTTCGAAAGAATCCTCAAACCTCGAGGTTTGAGGATTCTTTCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-547s21c1
Sequence:CCGGACACAGCTTTCAATGTCATTTCTCGAGAAATGACATTGAAAGCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-595s21c1
Sequence:CCGGGTACGAGACAGTGGACATATTCTCGAGAATATGTCCACTGTCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-408s21c1
Sequence:CCGGTCGGAAGGATGATTTCGTTATCTCGAGATAACGAAATCATCCTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032930
C11orf70 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 70
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-721s1c1
Sequence:CCGGGATAGAGAAGAGTTCCTGTTTCTCGAGAAACAGGAACTCTTCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-787s1c1
Sequence:CCGGGAGGATGTGATTAGCCCATATCTCGAGATATGGGCTAATCACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-656s1c1
Sequence:CCGGCTGATGAGTTACGAAGAGTTTCTCGAGAAACTCTTCGTAACTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032930.1-598s1c1
Sequence:CCGGCGAGACAGTGGACATATTGTTCTCGAGAACAATATGTCCACTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-714s1c1
Sequence:CCGGCCAACCAGATAGAGAAGAGTTCTCGAGAACTCTTCTCTATCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032930.1-442s1c1
Sequence:CCGGGACCCAAATGTTATTCCCAATCTCGAGATTGGGAATAACATTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032930.1-772s1c1
Sequence:CCGGGCCCTTTGTCAATATGAGGATCTCGAGATCCTCATATTGACAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032930.1-800s1c1
Sequence:CCGGGCCCATATCTGGAAACAACAACTCGAGTTGTTGTTTCCAGATATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-846s21c1
Sequence:CCGGTGTTCGAAAGAATCCTCAAACCTCGAGGTTTGAGGATTCTTTCGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-547s21c1
Sequence:CCGGACACAGCTTTCAATGTCATTTCTCGAGAAATGACATTGAAAGCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-595s21c1
Sequence:CCGGGTACGAGACAGTGGACATATTCTCGAGAATATGTCCACTGTCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032930.1-408s21c1
Sequence:CCGGTCGGAAGGATGATTTCGTTATCTCGAGATAACGAAATCATCCTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks