EMAIL THIS PAGE TO A FRIEND

C11orf71

chromosome 11 open reading frame 71

32 Gene Product Result for
Species: Human C11orf71(54494)
UniProtKB ID: Q6IPW1, Q6IAD3, Q9NXX1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019021 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058051 MISSION® esiRNA esiRNA human C11orf71 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019021 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352551 predicted 264
2 SASI_Hs02_00352552 predicted 213
3 SASI_Hs02_00352553 predicted 214
4 SASI_Hs02_00352554 predicted 244
5 SASI_Hs02_00352555 predicted 206
6 SASI_Hs02_00352556 predicted 270
7 SASI_Hs02_00352557 predicted 197
8 SASI_Hs02_00352558 predicted 391
9 SASI_Hs02_00352559 predicted 404
10 SASI_Hs02_00352560 predicted 368
11 SASI_Hs01_00225185 predicted 848
12 SASI_Hs01_00225186 predicted 915
13 SASI_Hs01_00225187 predicted 672
14 SASI_Hs01_00225188 predicted 999
15 SASI_Hs01_00225189 predicted 863
16 SASI_Hs01_00225190 predicted 525
17 SASI_Hs01_00225191 predicted 543
18 SASI_Hs01_00225192 predicted 437
19 SASI_Hs01_00225193 predicted 767
20 SASI_Hs01_00225194 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019021
C11orf71 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 71
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019021.2-485s21c1
Sequence:CCGGTTCAACATGCAGCCATTCAAACTCGAGTTTGAATGGCTGCATGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-531s1c1
Sequence:CCGGCGCAGCTCGAATTTCAGTTTACTCGAGTAAACTGAAATTCGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-316s1c1
Sequence:CCGGCCTGAAGCGATTCATCTAGGACTCGAGTCCTAGATGAATCGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-510s1c1
Sequence:CCGGGATTGCATTAGGAGGTGTTATCTCGAGATAACACCTCCTAATGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-435s1c1
Sequence:CCGGCCAAGCCAGATTCTCACCTTACTCGAGTAAGGTGAGAATCTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-498s1c1
Sequence:CCGGGCAACAGCGTTTGATTGCATTCTCGAGAATGCAATCAAACGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019021
C11orf71 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 71
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019021.2-485s21c1
Sequence:CCGGTTCAACATGCAGCCATTCAAACTCGAGTTTGAATGGCTGCATGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-531s1c1
Sequence:CCGGCGCAGCTCGAATTTCAGTTTACTCGAGTAAACTGAAATTCGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-316s1c1
Sequence:CCGGCCTGAAGCGATTCATCTAGGACTCGAGTCCTAGATGAATCGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-510s1c1
Sequence:CCGGGATTGCATTAGGAGGTGTTATCTCGAGATAACACCTCCTAATGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-435s1c1
Sequence:CCGGCCAAGCCAGATTCTCACCTTACTCGAGTAAGGTGAGAATCTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-498s1c1
Sequence:CCGGGCAACAGCGTTTGATTGCATTCTCGAGAATGCAATCAAACGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019021
C11orf71 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 71
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019021.2-485s21c1
Sequence:CCGGTTCAACATGCAGCCATTCAAACTCGAGTTTGAATGGCTGCATGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-531s1c1
Sequence:CCGGCGCAGCTCGAATTTCAGTTTACTCGAGTAAACTGAAATTCGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-316s1c1
Sequence:CCGGCCTGAAGCGATTCATCTAGGACTCGAGTCCTAGATGAATCGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-510s1c1
Sequence:CCGGGATTGCATTAGGAGGTGTTATCTCGAGATAACACCTCCTAATGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-435s1c1
Sequence:CCGGCCAAGCCAGATTCTCACCTTACTCGAGTAAGGTGAGAATCTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019021.1-498s1c1
Sequence:CCGGGCAACAGCGTTTGATTGCATTCTCGAGAATGCAATCAAACGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks