EMAIL THIS PAGE TO A FRIEND

C11orf73

chromosome 11 open reading frame 73

Synonyms: HSPC179 Hikeshi L7RN6 OPI10
Species: Human C11orf73(51501)
UniProtKB ID: Q53FT3, Q8WVE8, Q9NVQ2, Q9NZZ1, Q9P022, Q9P0N1
Gene ID:
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016411 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147341 MISSION® esiRNA esiRNA human C11orf73 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016401 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066667 predicted 531
2 SASI_Hs01_00066668 predicted 250
3 SASI_Hs01_00066669 predicted 686
4 SASI_Hs01_00066670 predicted 432
5 SASI_Hs01_00066671 predicted 402
6 SASI_Hs01_00066673 predicted 632
7 SASI_Hs02_00349412 predicted 684
8 SASI_Hs01_00066674 predicted 471
9 SASI_Hs01_00066675 predicted 275
10 SASI_Hs01_00066676 predicted 536
11 SASI_Hs01_00066672 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016411
C11orf73 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 73
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-450s1c1
Sequence:CCGGGAAGCCAAGTGCCATCTTCAACTCGAGTTGAAGATGGCACTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016411.1-416s1c1
Sequence:CCGGCAGTATGGCAACTCCTAGGATCTCGAGATCCTAGGAGTTGCCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-367s1c1
Sequence:CCGGGAATGGGAGGATCTGTCTACTCTCGAGAGTAGACAGATCCTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-418s1c1
Sequence:CCGGGTATGGCAACTCCTAGGATTTCTCGAGAAATCCTAGGAGTTGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-397s1c1
Sequence:CCGGCCTGATTCAAATGGAATGCCACTCGAGTGGCATTCCATTTGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-269s1c1
Sequence:CCGGGCAAGTGGCAGAGGATAAATTCTCGAGAATTTATCCTCTGCCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016411
C11orf73 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 73
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-450s1c1
Sequence:CCGGGAAGCCAAGTGCCATCTTCAACTCGAGTTGAAGATGGCACTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016411.1-416s1c1
Sequence:CCGGCAGTATGGCAACTCCTAGGATCTCGAGATCCTAGGAGTTGCCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-367s1c1
Sequence:CCGGGAATGGGAGGATCTGTCTACTCTCGAGAGTAGACAGATCCTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-418s1c1
Sequence:CCGGGTATGGCAACTCCTAGGATTTCTCGAGAAATCCTAGGAGTTGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-397s1c1
Sequence:CCGGCCTGATTCAAATGGAATGCCACTCGAGTGGCATTCCATTTGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-269s1c1
Sequence:CCGGGCAAGTGGCAGAGGATAAATTCTCGAGAATTTATCCTCTGCCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016411
C11orf73 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 73
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-450s1c1
Sequence:CCGGGAAGCCAAGTGCCATCTTCAACTCGAGTTGAAGATGGCACTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016411.1-416s1c1
Sequence:CCGGCAGTATGGCAACTCCTAGGATCTCGAGATCCTAGGAGTTGCCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-367s1c1
Sequence:CCGGGAATGGGAGGATCTGTCTACTCTCGAGAGTAGACAGATCCTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-418s1c1
Sequence:CCGGGTATGGCAACTCCTAGGATTTCTCGAGAAATCCTAGGAGTTGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-397s1c1
Sequence:CCGGCCTGATTCAAATGGAATGCCACTCGAGTGGCATTCCATTTGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016411.1-269s1c1
Sequence:CCGGGCAAGTGGCAGAGGATAAATTCTCGAGAATTTATCCTCTGCCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks