EMAIL THIS PAGE TO A FRIEND

C11orf74

chromosome 11 open reading frame 74

52 Gene Product Result for
Synonyms: HEPIS
Species: Human C11orf74(119710)
UniProtKB ID: Q86VG3, D3DR18, Q96DD6
Gene ID:
Human(119710) Summary: This gene encodes a protein that was identified as a cellular interacting partner of non-structural protein 10 of the severe acute respiratory syndrome coronavirus (SARS-CoV). The encoded protein may function as a negative regulator of transcription. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138787 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148871 MISSION® esiRNA esiRNA human C11orf74 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138787 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075071 predicted 521
2 SASI_Hs01_00075072 predicted 288
3 SASI_Hs02_00363917 predicted 519
4 SASI_Hs02_00363918 predicted 293
5 SASI_Hs02_00363919 predicted 570
6 SASI_Hs01_00075064 predicted 328
7 SASI_Hs01_00075065 predicted 364
8 SASI_Hs01_00075066 predicted 232
9 SASI_Hs01_00075067 predicted 235
10 SASI_Hs01_00075068 predicted 499
11 SASI_Hs01_00075069 predicted 567
12 SASI_Hs01_00075070 predicted 368
13 SASI_Hs01_00075073 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138787
C11orf74 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 74
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-667s1c1
Sequence:CCGGGAACATCAAAGAGCTATGCAACTCGAGTTGCATAGCTCTTTGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-472s1c1
Sequence:CCGGCACCAGCATTCCTTCCTGTATCTCGAGATACAGGAAGGAATGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-296s1c1
Sequence:CCGGGCAGATGACTACCATCTTAGACTCGAGTCTAAGATGGTAGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-206s1c1
Sequence:CCGGCAAGAGGATCATGTGTCCAAACTCGAGTTTGGACACATGATCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-347s1c1
Sequence:CCGGCAATGTTTGGAAGAACAGGTACTCGAGTACCTGTTCTTCCAAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-324s1c1
Sequence:CCGGCCATCTTTCTTCGTACTTCATCTCGAGATGAAGTACGAAGAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-197s1c1
Sequence:CCGGCATCTTTCACAAGAGGATCATCTCGAGATGATCCTCTTGTGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-656s1c1
Sequence:CCGGGCAGAGATAGAGAACATCAAACTCGAGTTTGATGTTCTCTATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-351s1c1
Sequence:CCGGGTTTGGAAGAACAGGTAGATACTCGAGTATCTACCTGTTCTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-566s1c1
Sequence:CCGGGAAGAGATACTTGGAGATGAACTCGAGTTCATCTCCAAGTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-231s1c1
Sequence:CCGGGAGTGTTTGGAACTGATTCTTCTCGAGAAGAATCAGTTCCAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138787
C11orf74 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 74
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-667s1c1
Sequence:CCGGGAACATCAAAGAGCTATGCAACTCGAGTTGCATAGCTCTTTGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-472s1c1
Sequence:CCGGCACCAGCATTCCTTCCTGTATCTCGAGATACAGGAAGGAATGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-296s1c1
Sequence:CCGGGCAGATGACTACCATCTTAGACTCGAGTCTAAGATGGTAGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-206s1c1
Sequence:CCGGCAAGAGGATCATGTGTCCAAACTCGAGTTTGGACACATGATCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-347s1c1
Sequence:CCGGCAATGTTTGGAAGAACAGGTACTCGAGTACCTGTTCTTCCAAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-324s1c1
Sequence:CCGGCCATCTTTCTTCGTACTTCATCTCGAGATGAAGTACGAAGAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-197s1c1
Sequence:CCGGCATCTTTCACAAGAGGATCATCTCGAGATGATCCTCTTGTGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-656s1c1
Sequence:CCGGGCAGAGATAGAGAACATCAAACTCGAGTTTGATGTTCTCTATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-351s1c1
Sequence:CCGGGTTTGGAAGAACAGGTAGATACTCGAGTATCTACCTGTTCTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-566s1c1
Sequence:CCGGGAAGAGATACTTGGAGATGAACTCGAGTTCATCTCCAAGTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-231s1c1
Sequence:CCGGGAGTGTTTGGAACTGATTCTTCTCGAGAAGAATCAGTTCCAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138787
C11orf74 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 74
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-667s1c1
Sequence:CCGGGAACATCAAAGAGCTATGCAACTCGAGTTGCATAGCTCTTTGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-472s1c1
Sequence:CCGGCACCAGCATTCCTTCCTGTATCTCGAGATACAGGAAGGAATGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-296s1c1
Sequence:CCGGGCAGATGACTACCATCTTAGACTCGAGTCTAAGATGGTAGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-206s1c1
Sequence:CCGGCAAGAGGATCATGTGTCCAAACTCGAGTTTGGACACATGATCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-347s1c1
Sequence:CCGGCAATGTTTGGAAGAACAGGTACTCGAGTACCTGTTCTTCCAAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-324s1c1
Sequence:CCGGCCATCTTTCTTCGTACTTCATCTCGAGATGAAGTACGAAGAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-197s1c1
Sequence:CCGGCATCTTTCACAAGAGGATCATCTCGAGATGATCCTCTTGTGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-656s1c1
Sequence:CCGGGCAGAGATAGAGAACATCAAACTCGAGTTTGATGTTCTCTATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-351s1c1
Sequence:CCGGGTTTGGAAGAACAGGTAGATACTCGAGTATCTACCTGTTCTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138787.2-566s1c1
Sequence:CCGGGAAGAGATACTTGGAGATGAACTCGAGTTCATCTCCAAGTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138787.2-231s1c1
Sequence:CCGGGAGTGTTTGGAACTGATTCTTCTCGAGAAGAATCAGTTCCAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks