EMAIL THIS PAGE TO A FRIEND

C11orf80

chromosome 11 open reading frame 80

21 Gene Product Result for
Species: Human C11orf80(79703)
UniProtKB ID: Q8N6T0, Q9H677
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024650 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085461 MISSION® esiRNA esiRNA human C11orf80 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024650 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203412 predicted 1017
2 SASI_Hs01_00203413 predicted 1112
3 SASI_Hs01_00203416 predicted 1146
4 SASI_Hs01_00203417 predicted 732
5 SASI_Hs01_00203418 predicted 1264
6 SASI_Hs01_00203420 predicted 1247
7 SASI_Hs02_00357046 predicted 1582
8 SASI_Hs02_00357047 predicted 1254
9 SASI_Hs02_00357048 predicted 1017
10 SASI_Hs02_00357049 predicted 1291
11 SASI_Hs01_00203411 predicted 956
12 SASI_Hs01_00203414 predicted 796
13 SASI_Hs01_00203415 predicted 952
14 SASI_Hs01_00203419 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024650
VALIDATED
C11orf80 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 80
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024650.2-1612s1c1
Sequence:CCGGGCACAAAGTATTTCGTGAGATCTCGAGATCTCACGAAATACTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1521s1c1
Sequence:CCGGGTATTCTGACTGGAAGCACTACTCGAGTAGTGCTTCCAGTCAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024650.2-841s1c1
Sequence:CCGGCCAGCATTATGTGAGACCAAACTCGAGTTTGGTCTCACATAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-719s1c1
Sequence:CCGGCACCCTAAGGTCAGATTTCATCTCGAGATGAAATCTGACCTTAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024650.2-1017s1c1
Sequence:CCGGCCAACCAGCTTAACAGGATTTCTCGAGAAATCCTGTTAAGCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024650.2-1417s1c1
Sequence:CCGGCATCCAATTCACTGTGGACAACTCGAGTTGTCCACAGTGAATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1214s1c1
Sequence:CCGGGATGTGAGTTATCAGGTGGAACTCGAGTTCCACCTGATAACTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1102s1c1
Sequence:CCGGGCCGATGACTACTTTCTTCAACTCGAGTTGAAGAAAGTAGTCATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024650.2-579s1c1
Sequence:CCGGCTTCAGAGGAAGGCAGCTATTCTCGAGAATAGCTGCCTTCCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1247s1c1
Sequence:CCGGGATCAGTCTCAGACTATGGATCTCGAGATCCATAGTCTGAGACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024650.3-1180s21c1
Sequence:CCGGTCTCAATTTGGATAGAGATTTCTCGAGAAATCTCTATCCAAATTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024650.3-2089s21c1
Sequence:CCGGGCCGTTATCCCGTGGTTTAATCTCGAGATTAAACCACGGGATAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024650.3-1157s21c1
Sequence:CCGGTTGTGTATGATACCCAATTTGCTCGAGCAAATTGGGTATCATACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024650.3-615s21c1
Sequence:CCGGTAACACCCTTCCAGATGATTTCTCGAGAAATCATCTGGAAGGGTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024650
VALIDATED
C11orf80 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 80
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024650.2-1612s1c1
Sequence:CCGGGCACAAAGTATTTCGTGAGATCTCGAGATCTCACGAAATACTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1521s1c1
Sequence:CCGGGTATTCTGACTGGAAGCACTACTCGAGTAGTGCTTCCAGTCAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024650.2-841s1c1
Sequence:CCGGCCAGCATTATGTGAGACCAAACTCGAGTTTGGTCTCACATAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-719s1c1
Sequence:CCGGCACCCTAAGGTCAGATTTCATCTCGAGATGAAATCTGACCTTAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024650.2-1017s1c1
Sequence:CCGGCCAACCAGCTTAACAGGATTTCTCGAGAAATCCTGTTAAGCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024650.2-1417s1c1
Sequence:CCGGCATCCAATTCACTGTGGACAACTCGAGTTGTCCACAGTGAATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1214s1c1
Sequence:CCGGGATGTGAGTTATCAGGTGGAACTCGAGTTCCACCTGATAACTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1102s1c1
Sequence:CCGGGCCGATGACTACTTTCTTCAACTCGAGTTGAAGAAAGTAGTCATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024650.2-579s1c1
Sequence:CCGGCTTCAGAGGAAGGCAGCTATTCTCGAGAATAGCTGCCTTCCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1247s1c1
Sequence:CCGGGATCAGTCTCAGACTATGGATCTCGAGATCCATAGTCTGAGACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024650.3-1180s21c1
Sequence:CCGGTCTCAATTTGGATAGAGATTTCTCGAGAAATCTCTATCCAAATTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024650.3-2089s21c1
Sequence:CCGGGCCGTTATCCCGTGGTTTAATCTCGAGATTAAACCACGGGATAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024650.3-1157s21c1
Sequence:CCGGTTGTGTATGATACCCAATTTGCTCGAGCAAATTGGGTATCATACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024650.3-615s21c1
Sequence:CCGGTAACACCCTTCCAGATGATTTCTCGAGAAATCATCTGGAAGGGTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024650
VALIDATED
C11orf80 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 80
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024650.2-1612s1c1
Sequence:CCGGGCACAAAGTATTTCGTGAGATCTCGAGATCTCACGAAATACTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1521s1c1
Sequence:CCGGGTATTCTGACTGGAAGCACTACTCGAGTAGTGCTTCCAGTCAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024650.2-841s1c1
Sequence:CCGGCCAGCATTATGTGAGACCAAACTCGAGTTTGGTCTCACATAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-719s1c1
Sequence:CCGGCACCCTAAGGTCAGATTTCATCTCGAGATGAAATCTGACCTTAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024650.2-1017s1c1
Sequence:CCGGCCAACCAGCTTAACAGGATTTCTCGAGAAATCCTGTTAAGCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024650.2-1417s1c1
Sequence:CCGGCATCCAATTCACTGTGGACAACTCGAGTTGTCCACAGTGAATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1214s1c1
Sequence:CCGGGATGTGAGTTATCAGGTGGAACTCGAGTTCCACCTGATAACTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1102s1c1
Sequence:CCGGGCCGATGACTACTTTCTTCAACTCGAGTTGAAGAAAGTAGTCATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024650.2-579s1c1
Sequence:CCGGCTTCAGAGGAAGGCAGCTATTCTCGAGAATAGCTGCCTTCCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024650.2-1247s1c1
Sequence:CCGGGATCAGTCTCAGACTATGGATCTCGAGATCCATAGTCTGAGACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024650.3-1180s21c1
Sequence:CCGGTCTCAATTTGGATAGAGATTTCTCGAGAAATCTCTATCCAAATTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024650.3-2089s21c1
Sequence:CCGGGCCGTTATCCCGTGGTTTAATCTCGAGATTAAACCACGGGATAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024650.3-1157s21c1
Sequence:CCGGTTGTGTATGATACCCAATTTGCTCGAGCAAATTGGGTATCATACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024650.3-615s21c1
Sequence:CCGGTAACACCCTTCCAGATGATTTCTCGAGAAATCATCTGGAAGGGTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks