EMAIL THIS PAGE TO A FRIEND

C11orf82

chromosome 11 open reading frame 82

35 Gene Product Result for
Synonyms: noxin
Species: Human C11orf82(220042)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145018 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024181 MISSION® esiRNA esiRNA human C11orf82 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145018 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057224 predicted 2717
2 SASI_Hs02_00364870 predicted 2020
3 SASI_Hs01_00057225 predicted 478
4 SASI_Hs01_00057226 predicted 1383
5 SASI_Hs02_00364871 predicted 992
6 SASI_Hs01_00057228 predicted 1364
7 SASI_Hs01_00057229 predicted 526
8 SASI_Hs02_00364872 predicted 1188
9 SASI_Hs02_00364873 predicted 1523
10 SASI_Hs01_00057232 predicted 1202
11 SASI_Hs01_00057223 predicted 2276
12 SASI_Hs01_00057227 predicted 719
13 SASI_Hs01_00057230 predicted 458
14 SASI_Hs01_00057231 predicted 3129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145018
C11orf82 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 82
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-1497s1c1
Sequence:CCGGCTTGAAAGTGAGATTGCTGTACTCGAGTACAGCAATCTCACTTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-1386s1c1
Sequence:CCGGCCACCTTCGTTACTCAGACTTCTCGAGAAGTCTGAGTAACGAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-639s1c1
Sequence:CCGGGCCAGTAACTTCTTACAGCAACTCGAGTTGCTGTAAGAAGTTACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-2883s1c1
Sequence:CCGGGCCTATCATTTCCCTGATCAACTCGAGTTGATCAGGGAAATGATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-859s1c1
Sequence:CCGGGCACATATACTTCTGACAGCACTCGAGTGCTGTCAGAAGTATATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145018.2-3296s1c1
Sequence:CCGGGAACACTTGGAGAGAAGCAAACTCGAGTTTGCTTCTCTCCAAGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-3160s1c1
Sequence:CCGGCTTCAGTGTGTGAAACTCGAACTCGAGTTCGAGTTTCACACACTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-1491s1c1
Sequence:CCGGGCAGTTCTTGAAAGTGAGATTCTCGAGAATCTCACTTTCAAGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145018.2-3274s1c1
Sequence:CCGGCGGAAAGCATTCTTTACATTTCTCGAGAAATGTAAAGAATGCTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-1910s1c1
Sequence:CCGGGAGTGACCATTCTAGTCTAAACTCGAGTTTAGACTAGAATGGTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145018.2-3301s1c1
Sequence:CCGGCTTGGAGAGAAGCAAATTGAACTCGAGTTCAATTTGCTTCTCTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-807s1c1
Sequence:CCGGGCACCTAACAATCACTTACTTCTCGAGAAGTAAGTGATTGTTAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145018
C11orf82 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 82
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-1497s1c1
Sequence:CCGGCTTGAAAGTGAGATTGCTGTACTCGAGTACAGCAATCTCACTTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-1386s1c1
Sequence:CCGGCCACCTTCGTTACTCAGACTTCTCGAGAAGTCTGAGTAACGAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-639s1c1
Sequence:CCGGGCCAGTAACTTCTTACAGCAACTCGAGTTGCTGTAAGAAGTTACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-2883s1c1
Sequence:CCGGGCCTATCATTTCCCTGATCAACTCGAGTTGATCAGGGAAATGATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-859s1c1
Sequence:CCGGGCACATATACTTCTGACAGCACTCGAGTGCTGTCAGAAGTATATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145018.2-3296s1c1
Sequence:CCGGGAACACTTGGAGAGAAGCAAACTCGAGTTTGCTTCTCTCCAAGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-3160s1c1
Sequence:CCGGCTTCAGTGTGTGAAACTCGAACTCGAGTTCGAGTTTCACACACTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-1491s1c1
Sequence:CCGGGCAGTTCTTGAAAGTGAGATTCTCGAGAATCTCACTTTCAAGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145018.2-3274s1c1
Sequence:CCGGCGGAAAGCATTCTTTACATTTCTCGAGAAATGTAAAGAATGCTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-1910s1c1
Sequence:CCGGGAGTGACCATTCTAGTCTAAACTCGAGTTTAGACTAGAATGGTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145018.2-3301s1c1
Sequence:CCGGCTTGGAGAGAAGCAAATTGAACTCGAGTTCAATTTGCTTCTCTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-807s1c1
Sequence:CCGGGCACCTAACAATCACTTACTTCTCGAGAAGTAAGTGATTGTTAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145018
C11orf82 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 82
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-1497s1c1
Sequence:CCGGCTTGAAAGTGAGATTGCTGTACTCGAGTACAGCAATCTCACTTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-1386s1c1
Sequence:CCGGCCACCTTCGTTACTCAGACTTCTCGAGAAGTCTGAGTAACGAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-639s1c1
Sequence:CCGGGCCAGTAACTTCTTACAGCAACTCGAGTTGCTGTAAGAAGTTACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-2883s1c1
Sequence:CCGGGCCTATCATTTCCCTGATCAACTCGAGTTGATCAGGGAAATGATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-859s1c1
Sequence:CCGGGCACATATACTTCTGACAGCACTCGAGTGCTGTCAGAAGTATATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145018.2-3296s1c1
Sequence:CCGGGAACACTTGGAGAGAAGCAAACTCGAGTTTGCTTCTCTCCAAGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145018.2-3160s1c1
Sequence:CCGGCTTCAGTGTGTGAAACTCGAACTCGAGTTCGAGTTTCACACACTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-1491s1c1
Sequence:CCGGGCAGTTCTTGAAAGTGAGATTCTCGAGAATCTCACTTTCAAGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145018.2-3274s1c1
Sequence:CCGGCGGAAAGCATTCTTTACATTTCTCGAGAAATGTAAAGAATGCTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-1910s1c1
Sequence:CCGGGAGTGACCATTCTAGTCTAAACTCGAGTTTAGACTAGAATGGTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145018.2-3301s1c1
Sequence:CCGGCTTGGAGAGAAGCAAATTGAACTCGAGTTCAATTTGCTTCTCTCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145018.2-807s1c1
Sequence:CCGGGCACCTAACAATCACTTACTTCTCGAGAAGTAAGTGATTGTTAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)