EMAIL THIS PAGE TO A FRIEND

C11orf83

chromosome 11 open reading frame 83

14 Gene Product Result for
Synonyms: CCDS41658.1 UNQ655
Species: Human C11orf83(790955)
UniProtKB ID: Q6UW78, Q5FVD5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085372 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085372 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317516 predicted 416
2 SASI_Hs02_00317517 predicted 391
3 SASI_Hs02_00317518 predicted 322
4 SASI_Hs02_00317519 predicted 349
5 SASI_Hs02_00317520 predicted 260
6 SASI_Hs02_00317521 predicted 380
7 SASI_Hs02_00317522 predicted 401
8 SASI_Hs02_00317523 predicted 258
9 SASI_Hs02_00317524 predicted 258
10 SASI_Hs02_00317525 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085372
VALIDATED
C11orf83 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 83
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085372.1-191s21c1
Sequence:CCGGGCGGAAGCAGGAAATGCTAAACTCGAGTTTAGCATTTCCTGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085372.1-471s21c1
Sequence:CCGGAGATACCATGCCAGGACTCTCCTCGAGGAGAGTCCTGGCATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085372.1-155s21c1
Sequence:CCGGCTACGCGCTCCTCGTTATCGTCTCGAGACGATAACGAGGAGCGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085372.1-254s21c1
Sequence:CCGGCAGGACCCAGCAGCTATTGCTCTCGAGAGCAATAGCTGCTGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085372.1-321s21c1
Sequence:CCGGAGGAAGAACTGGATGGTTGGCCTCGAGGCCAACCATCCAGTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085372
VALIDATED
C11orf83 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 83
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085372.1-191s21c1
Sequence:CCGGGCGGAAGCAGGAAATGCTAAACTCGAGTTTAGCATTTCCTGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085372.1-471s21c1
Sequence:CCGGAGATACCATGCCAGGACTCTCCTCGAGGAGAGTCCTGGCATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085372.1-155s21c1
Sequence:CCGGCTACGCGCTCCTCGTTATCGTCTCGAGACGATAACGAGGAGCGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085372.1-254s21c1
Sequence:CCGGCAGGACCCAGCAGCTATTGCTCTCGAGAGCAATAGCTGCTGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085372.1-321s21c1
Sequence:CCGGAGGAAGAACTGGATGGTTGGCCTCGAGGCCAACCATCCAGTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085372
VALIDATED
C11orf83 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 83
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085372.1-191s21c1
Sequence:CCGGGCGGAAGCAGGAAATGCTAAACTCGAGTTTAGCATTTCCTGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085372.1-471s21c1
Sequence:CCGGAGATACCATGCCAGGACTCTCCTCGAGGAGAGTCCTGGCATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085372.1-155s21c1
Sequence:CCGGCTACGCGCTCCTCGTTATCGTCTCGAGACGATAACGAGGAGCGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085372.1-254s21c1
Sequence:CCGGCAGGACCCAGCAGCTATTGCTCTCGAGAGCAATAGCTGCTGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001085372.1-321s21c1
Sequence:CCGGAGGAAGAACTGGATGGTTGGCCTCGAGGCCAACCATCCAGTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks