EMAIL THIS PAGE TO A FRIEND

C11orf84

chromosome 11 open reading frame 84

22 Gene Product Result for
Species: Human C11orf84(144097)
UniProtKB ID: Q9BUA3, Q68CV7, Q6PHS2, Q96IH0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138471 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032051 MISSION® esiRNA esiRNA human C11orf84 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138471 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146962 predicted 779
2 SASI_Hs01_00146963 predicted 583
3 SASI_Hs01_00146964 predicted 753
4 SASI_Hs02_00363663 predicted 1047
5 SASI_Hs01_00146965 predicted 731
6 SASI_Hs01_00146966 predicted 1360
7 SASI_Hs01_00146967 predicted 1365
8 SASI_Hs01_00146968 predicted 1582
9 SASI_Hs01_00146969 predicted 543
10 SASI_Hs01_00146970 predicted 1199
11 SASI_Hs01_00146971 predicted 756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138471
VALIDATED
C11orf84 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 84
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-1316s21c1
Sequence:CCGGGCCCACAGTTCTGTCAGAATCCTCGAGGATTCTGACAGAACTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-767s21c1
Sequence:CCGGTCTCCTTGACTCTGAGGATAACTCGAGTTATCCTCAGAGTCAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-1724s21c1
Sequence:CCGGTTACACAAGAGTGGTCATAAGCTCGAGCTTATGACCACTCTTGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-599s21c1
Sequence:CCGGCCCTTCTGAGAAGAGCAATATCTCGAGATATTGCTCTTCTCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138471.1-598s1c1
Sequence:CCGGGCCCTTCTGAGAAGAGCAATACTCGAGTATTGCTCTTCTCAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138471
VALIDATED
C11orf84 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 84
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-1316s21c1
Sequence:CCGGGCCCACAGTTCTGTCAGAATCCTCGAGGATTCTGACAGAACTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-767s21c1
Sequence:CCGGTCTCCTTGACTCTGAGGATAACTCGAGTTATCCTCAGAGTCAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-1724s21c1
Sequence:CCGGTTACACAAGAGTGGTCATAAGCTCGAGCTTATGACCACTCTTGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-599s21c1
Sequence:CCGGCCCTTCTGAGAAGAGCAATATCTCGAGATATTGCTCTTCTCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138471.1-598s1c1
Sequence:CCGGGCCCTTCTGAGAAGAGCAATACTCGAGTATTGCTCTTCTCAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138471
VALIDATED
C11orf84 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 84
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-1316s21c1
Sequence:CCGGGCCCACAGTTCTGTCAGAATCCTCGAGGATTCTGACAGAACTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-767s21c1
Sequence:CCGGTCTCCTTGACTCTGAGGATAACTCGAGTTATCCTCAGAGTCAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-1724s21c1
Sequence:CCGGTTACACAAGAGTGGTCATAAGCTCGAGCTTATGACCACTCTTGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138471.1-599s21c1
Sequence:CCGGCCCTTCTGAGAAGAGCAATATCTCGAGATATTGCTCTTCTCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138471.1-598s1c1
Sequence:CCGGGCCCTTCTGAGAAGAGCAATACTCGAGTATTGCTCTTCTCAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks