EMAIL THIS PAGE TO A FRIEND

C11orf85

chromosome 11 open reading frame 85

62 Gene Product Result for
Species: Human C11orf85(283129)
UniProtKB ID: Q3KP22
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037225 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037225 Rosetta Predictions human pricing
XM_929824 Rosetta Predictions human pricing
XM_933985 Rosetta Predictions human pricing
XM_933990 Rosetta Predictions human pricing
XM_933994 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096144 predicted 407
2 SASI_Hs01_00096146 predicted 426
3 SASI_Hs01_00096148 predicted 418
4 SASI_Hs01_00096149 predicted 477
5 SASI_Hs02_00308235 predicted 597
6 SASI_Hs02_00308236 predicted 221
7 SASI_Hs01_00096152 predicted 378
8 SASI_Hs01_00096153 predicted 560
9 SASI_Hs02_00308237 predicted 311
10 SASI_Hs02_00308238 predicted 236
11 SASI_Hs01_00096145 predicted 260
12 SASI_Hs01_00096147 predicted 280
13 SASI_Hs01_00096150 predicted 319
14 SASI_Hs01_00096151 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260437 predicted 335
2 SASI_Hs01_00260438 predicted 365
3 SASI_Hs01_00260439 predicted 212
4 SASI_Hs01_00260440 predicted 317
5 SASI_Hs01_00260441 predicted 352
6 SASI_Hs01_00260442 predicted 410
7 SASI_Hs01_00260443 predicted 372
8 SASI_Hs01_00260444 predicted 242
9 SASI_Hs01_00260445 predicted 307
10 SASI_Hs01_00260446 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286206 predicted 405
2 SASI_Hs01_00286207 predicted 259
3 SASI_Hs01_00286208 predicted 435
4 SASI_Hs01_00286209 predicted 276
5 SASI_Hs01_00286210 predicted 416
6 SASI_Hs01_00286211 predicted 473
7 SASI_Hs01_00286212 predicted 314
8 SASI_Hs01_00286213 predicted 383
9 SASI_Hs01_00286214 predicted 368
10 SASI_Hs01_00286215 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278263 predicted 383
2 SASI_Hs01_00278264 predicted 729
3 SASI_Hs01_00278265 predicted 558
4 SASI_Hs01_00278266 predicted 749
5 SASI_Hs01_00278267 predicted 521
6 SASI_Hs01_00278268 predicted 236
7 SASI_Hs01_00278269 predicted 695
8 SASI_Hs01_00278270 predicted 448
9 SASI_Hs01_00278271 predicted 366
10 SASI_Hs01_00278272 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301169 predicted 1348
2 SASI_Hs01_00301170 predicted 1389
3 SASI_Hs01_00301171 predicted 1741
4 SASI_Hs01_00301172 predicted 1805
5 SASI_Hs01_00301173 predicted 1768
6 SASI_Hs01_00301174 predicted 1532
7 SASI_Hs01_00301175 predicted 1388
8 SASI_Hs01_00301176 predicted 1710
9 SASI_Hs01_00301177 predicted 1459
10 SASI_Hs01_00301178 predicted 1377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037225
C11orf85 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 85
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-605s1c1
Sequence:CCGGGATGTCCAGAAACAAGATTCTCTCGAGAGAATCTTGTTTCTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-263s1c1
Sequence:CCGGGCCCTTTGCTACAGAACACTTCTCGAGAAGTGTTCTGTAGCAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-429s1c1
Sequence:CCGGCCAATAAGTGACAGTCCTCTTCTCGAGAAGAGGACTGTCACTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-459s1c1
Sequence:CCGGCCAGTTGAGAAGAAAGCAGTACTCGAGTACTGCTTTCTTCTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-305s1c1
Sequence:CCGGCAAATGGGAGAGAGTTTCCCACTCGAGTGGGAAACTCTCTCCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-566s1c1
Sequence:CCGGCAACAAGGATTGCAGGAGACTCTCGAGAGTCTCCTGCAATCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-105s1c1
Sequence:CCGGCCAGAGACGAGGTTTCTTCATCTCGAGATGAAGAAACCTCGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-101s1c1
Sequence:CCGGGTTTCCAGAGACGAGGTTTCTCTCGAGAGAAACCTCGTCTCTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-252s1c1
Sequence:CCGGGACAATCTTCAGCCCTTTGCTCTCGAGAGCAAAGGGCTGAAGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-116s1c1
Sequence:CCGGGTTTCTTCATGCAGGACCCAACTCGAGTTGGGTCCTGCATGAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-540s1c1
Sequence:CCGGCTGGACAGAATAGGGAAAGAACTCGAGTTCTTTCCCTATTCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-164s1c1
Sequence:CCGGGAAGAGTATCAGAGGAGAAGACTCGAGTCTTCTCCTCTGATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-237s1c1
Sequence:CCGGGTCTTGGGAAACTTGGACAATCTCGAGATTGTCCAAGTTTCCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037225
C11orf85 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 85
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-605s1c1
Sequence:CCGGGATGTCCAGAAACAAGATTCTCTCGAGAGAATCTTGTTTCTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-263s1c1
Sequence:CCGGGCCCTTTGCTACAGAACACTTCTCGAGAAGTGTTCTGTAGCAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-429s1c1
Sequence:CCGGCCAATAAGTGACAGTCCTCTTCTCGAGAAGAGGACTGTCACTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-459s1c1
Sequence:CCGGCCAGTTGAGAAGAAAGCAGTACTCGAGTACTGCTTTCTTCTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-305s1c1
Sequence:CCGGCAAATGGGAGAGAGTTTCCCACTCGAGTGGGAAACTCTCTCCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-566s1c1
Sequence:CCGGCAACAAGGATTGCAGGAGACTCTCGAGAGTCTCCTGCAATCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-105s1c1
Sequence:CCGGCCAGAGACGAGGTTTCTTCATCTCGAGATGAAGAAACCTCGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-101s1c1
Sequence:CCGGGTTTCCAGAGACGAGGTTTCTCTCGAGAGAAACCTCGTCTCTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-252s1c1
Sequence:CCGGGACAATCTTCAGCCCTTTGCTCTCGAGAGCAAAGGGCTGAAGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-116s1c1
Sequence:CCGGGTTTCTTCATGCAGGACCCAACTCGAGTTGGGTCCTGCATGAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-540s1c1
Sequence:CCGGCTGGACAGAATAGGGAAAGAACTCGAGTTCTTTCCCTATTCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-164s1c1
Sequence:CCGGGAAGAGTATCAGAGGAGAAGACTCGAGTCTTCTCCTCTGATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-237s1c1
Sequence:CCGGGTCTTGGGAAACTTGGACAATCTCGAGATTGTCCAAGTTTCCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037225
C11orf85 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 85
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-605s1c1
Sequence:CCGGGATGTCCAGAAACAAGATTCTCTCGAGAGAATCTTGTTTCTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-263s1c1
Sequence:CCGGGCCCTTTGCTACAGAACACTTCTCGAGAAGTGTTCTGTAGCAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-429s1c1
Sequence:CCGGCCAATAAGTGACAGTCCTCTTCTCGAGAAGAGGACTGTCACTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-459s1c1
Sequence:CCGGCCAGTTGAGAAGAAAGCAGTACTCGAGTACTGCTTTCTTCTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-305s1c1
Sequence:CCGGCAAATGGGAGAGAGTTTCCCACTCGAGTGGGAAACTCTCTCCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-566s1c1
Sequence:CCGGCAACAAGGATTGCAGGAGACTCTCGAGAGTCTCCTGCAATCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-105s1c1
Sequence:CCGGCCAGAGACGAGGTTTCTTCATCTCGAGATGAAGAAACCTCGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-101s1c1
Sequence:CCGGGTTTCCAGAGACGAGGTTTCTCTCGAGAGAAACCTCGTCTCTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-252s1c1
Sequence:CCGGGACAATCTTCAGCCCTTTGCTCTCGAGAGCAAAGGGCTGAAGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-116s1c1
Sequence:CCGGGTTTCTTCATGCAGGACCCAACTCGAGTTGGGTCCTGCATGAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-540s1c1
Sequence:CCGGCTGGACAGAATAGGGAAAGAACTCGAGTTCTTTCCCTATTCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037225.1-164s1c1
Sequence:CCGGGAAGAGTATCAGAGGAGAAGACTCGAGTCTTCTCCTCTGATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037225.1-237s1c1
Sequence:CCGGGTCTTGGGAAACTTGGACAATCTCGAGATTGTCCAAGTTTCCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks