EMAIL THIS PAGE TO A FRIEND

C11orf86

chromosome 11 open reading frame 86

35 Gene Product Result for
Species: Human C11orf86(254439)
UniProtKB ID: A6NJI1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136485 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151121 MISSION® esiRNA esiRNA human C11orf86 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001129415 Rosetta Predictions human pricing
XM_001129697 Rosetta Predictions human pricing
XM_001721724 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001129415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00386067 predicted 773
2 SASI_Hs02_00386068 predicted 705
3 SASI_Hs02_00386069 predicted 300
4 SASI_Hs02_00386070 predicted 497
5 SASI_Hs02_00386071 predicted 864
6 SASI_Hs02_00386072 predicted 89
7 SASI_Hs02_00386073 predicted 856
8 SASI_Hs02_00386074 predicted 672
9 SASI_Hs02_00386075 predicted 705
10 SASI_Hs02_00386076 predicted 75
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001129697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00386442 predicted 705
2 SASI_Hs02_00386443 predicted 706
3 SASI_Hs02_00386444 predicted 298
4 SASI_Hs02_00386445 predicted 498
5 SASI_Hs02_00386446 predicted 620
6 SASI_Hs02_00386447 predicted 342
7 SASI_Hs02_00386448 predicted 770
8 SASI_Hs02_00386449 predicted 672
9 SASI_Hs02_00386450 predicted 697
10 SASI_Hs02_00386451 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00444624 predicted 713
2 SASI_Hs02_00444625 predicted 706
3 SASI_Hs02_00444626 predicted 300
4 SASI_Hs02_00444627 predicted 498
5 SASI_Hs02_00444628 predicted 618
6 SASI_Hs02_00444629 predicted 337
7 SASI_Hs02_00444630 predicted 672
8 SASI_Hs02_00444631 predicted 702
9 SASI_Hs02_00444632 predicted 703
10 SASI_Hs02_00444633 predicted 447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136485
C11orf86 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 86
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-372s21c1
Sequence:CCGGGAGAGCTTTGTCGCCATCTTCCTCGAGGAAGATGGCGACAAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-347s21c1
Sequence:CCGGGTACCAACAGGTAAGAAGAAGCTCGAGCTTCTTCTTACCTGTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136485.1-434s21c1
Sequence:CCGGACTGGGCACCATCAGCTAAAGCTCGAGCTTTAGCTGATGGTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-292s21c1
Sequence:CCGGACACAGAGCAGCTGATCCAAGCTCGAGCTTGGATCAGCTGCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-126s21c1
Sequence:CCGGTCCTATGGAAAGCTGCAGGAGCTCGAGCTCCTGCAGCTTTCCATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136485
C11orf86 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 86
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-372s21c1
Sequence:CCGGGAGAGCTTTGTCGCCATCTTCCTCGAGGAAGATGGCGACAAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-347s21c1
Sequence:CCGGGTACCAACAGGTAAGAAGAAGCTCGAGCTTCTTCTTACCTGTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136485.1-434s21c1
Sequence:CCGGACTGGGCACCATCAGCTAAAGCTCGAGCTTTAGCTGATGGTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-292s21c1
Sequence:CCGGACACAGAGCAGCTGATCCAAGCTCGAGCTTGGATCAGCTGCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-126s21c1
Sequence:CCGGTCCTATGGAAAGCTGCAGGAGCTCGAGCTCCTGCAGCTTTCCATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136485
C11orf86 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 86
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-372s21c1
Sequence:CCGGGAGAGCTTTGTCGCCATCTTCCTCGAGGAAGATGGCGACAAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-347s21c1
Sequence:CCGGGTACCAACAGGTAAGAAGAAGCTCGAGCTTCTTCTTACCTGTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136485.1-434s21c1
Sequence:CCGGACTGGGCACCATCAGCTAAAGCTCGAGCTTTAGCTGATGGTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-292s21c1
Sequence:CCGGACACAGAGCAGCTGATCCAAGCTCGAGCTTGGATCAGCTGCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136485.1-126s21c1
Sequence:CCGGTCCTATGGAAAGCTGCAGGAGCTCGAGCTCCTGCAGCTTTCCATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks