EMAIL THIS PAGE TO A FRIEND

C11orf87

chromosome 11 open reading frame 87

18 Gene Product Result for
Synonyms: LOH11CR1A
Species: Human C11orf87(399947)
UniProtKB ID: Q6NUJ2, B4E169
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207645 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006221 MISSION® esiRNA esiRNA targeting human C11orf87 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207645 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154640 predicted 519
2 SASI_Hs01_00154641 predicted 619
3 SASI_Hs01_00154642 predicted 586
4 SASI_Hs01_00154643 predicted 558
5 SASI_Hs01_00154644 predicted 563
6 SASI_Hs01_00154645 predicted 629
7 SASI_Hs01_00154647 predicted 741
8 SASI_Hs02_00374174 predicted 625
9 SASI_Hs01_00154648 predicted 644
10 SASI_Hs01_00154646 predicted 500
11 SASI_Hs01_00154649 predicted 1337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207645
C11orf87 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 87
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207645.3-984s21c1
Sequence:CCGGTGGTACTGTCCTGATCGTCTACTCGAGTAGACGATCAGGACAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207645.3-449s21c1
Sequence:CCGGTGTCTCCTCAACCGGACCTTTCTCGAGAAAGGTCCGGTTGAGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207645.1-625s1c1
Sequence:CCGGCATCCACAAGCGTAGGATGAACTCGAGTTCATCCTACGCTTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207645.1-618s1c1
Sequence:CCGGCTTTCCACATCCACAAGCGTACTCGAGTACGCTTGTGGATGTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207645.1-640s1c1
Sequence:CCGGGATGAAGAAGCGGAAGATGCACTCGAGTGCATCTTCCGCTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207645.1-1511s1c1
Sequence:CCGGGCTCAGGCAATAGTATATTATCTCGAGATAATATACTATTGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207645.1-1247s1c1
Sequence:CCGGCGCATGACAAATCACATAATTCTCGAGAATTATGTGATTTGTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207645
C11orf87 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 87
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207645.3-984s21c1
Sequence:CCGGTGGTACTGTCCTGATCGTCTACTCGAGTAGACGATCAGGACAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207645.3-449s21c1
Sequence:CCGGTGTCTCCTCAACCGGACCTTTCTCGAGAAAGGTCCGGTTGAGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207645.1-625s1c1
Sequence:CCGGCATCCACAAGCGTAGGATGAACTCGAGTTCATCCTACGCTTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207645.1-618s1c1
Sequence:CCGGCTTTCCACATCCACAAGCGTACTCGAGTACGCTTGTGGATGTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207645.1-640s1c1
Sequence:CCGGGATGAAGAAGCGGAAGATGCACTCGAGTGCATCTTCCGCTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207645.1-1511s1c1
Sequence:CCGGGCTCAGGCAATAGTATATTATCTCGAGATAATATACTATTGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207645.1-1247s1c1
Sequence:CCGGCGCATGACAAATCACATAATTCTCGAGAATTATGTGATTTGTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207645
C11orf87 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 87
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207645.3-984s21c1
Sequence:CCGGTGGTACTGTCCTGATCGTCTACTCGAGTAGACGATCAGGACAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207645.3-449s21c1
Sequence:CCGGTGTCTCCTCAACCGGACCTTTCTCGAGAAAGGTCCGGTTGAGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207645.1-625s1c1
Sequence:CCGGCATCCACAAGCGTAGGATGAACTCGAGTTCATCCTACGCTTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207645.1-618s1c1
Sequence:CCGGCTTTCCACATCCACAAGCGTACTCGAGTACGCTTGTGGATGTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207645.1-640s1c1
Sequence:CCGGGATGAAGAAGCGGAAGATGCACTCGAGTGCATCTTCCGCTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207645.1-1511s1c1
Sequence:CCGGGCTCAGGCAATAGTATATTATCTCGAGATAATATACTATTGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207645.1-1247s1c1
Sequence:CCGGCGCATGACAAATCACATAATTCTCGAGAATTATGTGATTTGTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks