EMAIL THIS PAGE TO A FRIEND

C11orf88

chromosome 11 open reading frame 88

60 Gene Product Result for
Species: Human C11orf88(399949)
UniProtKB ID: Q6PI97, E9PAN0, Q6ZRL3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_374933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374933 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049971 MISSION® esiRNA esiRNA human C11orf88 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100388 Rosetta Predictions human pricing
NM_207430 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321844 predicted 452
2 SASI_Hs02_00321845 predicted 227
3 SASI_Hs02_00321846 predicted 378
4 SASI_Hs02_00321847 predicted 304
5 SASI_Hs02_00321848 predicted 445
6 SASI_Hs02_00321849 predicted 294
7 SASI_Hs02_00321850 predicted 272
8 SASI_Hs02_00321851 predicted 283
9 SASI_Hs02_00321852 predicted 405
10 SASI_Hs02_00321853 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374065 predicted 661
2 SASI_Hs02_00374066 predicted 94
3 SASI_Hs02_00374067 predicted 637
4 SASI_Hs02_00374068 predicted 731
5 SASI_Hs02_00374069 predicted 620
6 SASI_Hs02_00374070 predicted 17
7 SASI_Hs02_00374071 predicted 480
8 SASI_Hs02_00374072 predicted 666
9 SASI_Hs02_00374073 predicted 302
10 SASI_Hs02_00374074 predicted 668
11 SASI_Hs01_00105792 predicted 982
12 SASI_Hs01_00105793 predicted 629
13 SASI_Hs01_00105794 predicted 639
14 SASI_Hs01_00105795 predicted 957
15 SASI_Hs01_00105796 predicted 1026
16 SASI_Hs01_00105797 predicted 729
17 SASI_Hs01_00105798 predicted 920
18 SASI_Hs01_00105799 predicted 1009
19 SASI_Hs01_00105800 predicted 998
20 SASI_Hs01_00105801 predicted 959
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374933
C11orf88 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 88
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-361s1c1
Sequence:CCGGCAGAATGAAGTGCAGTGGCATCTCGAGATGCCACTGCACTTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374933.1-1246s1c1
Sequence:CCGGGCTGTCAAAGTAACACCCTTACTCGAGTAAGGGTGTTACTTTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374933.1-1847s1c1
Sequence:CCGGCCTTCCAAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-294s1c1
Sequence:CCGGCCTAAAGATACAGGAATCTGACTCGAGTCAGATTCCTGTATCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374933.1-433s1c1
Sequence:CCGGGAAGAGATTCTCCAACTCTTACTCGAGTAAGAGTTGGAGAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374933.1-642s1c1
Sequence:CCGGCCCGTGTATTACAGATTTCTTCTCGAGAAGAAATCTGTAATACACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-466s1c1
Sequence:CCGGGAAGAAAGGATCTCGAAAGAACTCGAGTTCTTTCGAGATCCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-300s1c1
Sequence:CCGGGATACAGGAATCTGAGGAGAACTCGAGTTCTCCTCAGATTCCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-304s1c1
Sequence:CCGGCAGGAATCTGAGGAGAAAGTACTCGAGTACTTTCTCCTCAGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374933.1-484s1c1
Sequence:CCGGGAACTGATTTCCCTTCCGTATCTCGAGATACGGAAGGGAAATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374933
C11orf88 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 88
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-361s1c1
Sequence:CCGGCAGAATGAAGTGCAGTGGCATCTCGAGATGCCACTGCACTTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374933.1-1246s1c1
Sequence:CCGGGCTGTCAAAGTAACACCCTTACTCGAGTAAGGGTGTTACTTTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374933.1-1847s1c1
Sequence:CCGGCCTTCCAAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-294s1c1
Sequence:CCGGCCTAAAGATACAGGAATCTGACTCGAGTCAGATTCCTGTATCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374933.1-433s1c1
Sequence:CCGGGAAGAGATTCTCCAACTCTTACTCGAGTAAGAGTTGGAGAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374933.1-642s1c1
Sequence:CCGGCCCGTGTATTACAGATTTCTTCTCGAGAAGAAATCTGTAATACACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-466s1c1
Sequence:CCGGGAAGAAAGGATCTCGAAAGAACTCGAGTTCTTTCGAGATCCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-300s1c1
Sequence:CCGGGATACAGGAATCTGAGGAGAACTCGAGTTCTCCTCAGATTCCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-304s1c1
Sequence:CCGGCAGGAATCTGAGGAGAAAGTACTCGAGTACTTTCTCCTCAGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374933.1-484s1c1
Sequence:CCGGGAACTGATTTCCCTTCCGTATCTCGAGATACGGAAGGGAAATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374933
C11orf88 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 88
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-361s1c1
Sequence:CCGGCAGAATGAAGTGCAGTGGCATCTCGAGATGCCACTGCACTTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374933.1-1246s1c1
Sequence:CCGGGCTGTCAAAGTAACACCCTTACTCGAGTAAGGGTGTTACTTTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374933.1-1847s1c1
Sequence:CCGGCCTTCCAAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-294s1c1
Sequence:CCGGCCTAAAGATACAGGAATCTGACTCGAGTCAGATTCCTGTATCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374933.1-433s1c1
Sequence:CCGGGAAGAGATTCTCCAACTCTTACTCGAGTAAGAGTTGGAGAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374933.1-642s1c1
Sequence:CCGGCCCGTGTATTACAGATTTCTTCTCGAGAAGAAATCTGTAATACACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-466s1c1
Sequence:CCGGGAAGAAAGGATCTCGAAAGAACTCGAGTTCTTTCGAGATCCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-300s1c1
Sequence:CCGGGATACAGGAATCTGAGGAGAACTCGAGTTCTCCTCAGATTCCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_374933.1-304s1c1
Sequence:CCGGCAGGAATCTGAGGAGAAAGTACTCGAGTACTTTCTCCTCAGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374933.1-484s1c1
Sequence:CCGGGAACTGATTTCCCTTCCGTATCTCGAGATACGGAAGGGAAATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks