EMAIL THIS PAGE TO A FRIEND

C11orf94

chromosome 11 open reading frame 94

22 Gene Product Result for
Species: Human C11orf94(143678)
UniProtKB ID: C9JXX5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080446 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080446 Rosetta Predictions human pricing
XM_096472 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314916 predicted 291
2 SASI_Hs02_00314917 predicted 293
3 SASI_Hs02_00314918 predicted 300
4 SASI_Hs02_00314919 predicted 291
5 SASI_Hs02_00314920 predicted 185
6 SASI_Hs02_00314921 predicted 139
7 SASI_Hs02_00314922 predicted 290
8 SASI_Hs02_00314923 predicted 139
9 SASI_Hs02_00314924 predicted 332
10 SASI_Hs02_00314925 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_096472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263259 predicted 294
2 SASI_Hs01_00263260 predicted 291
3 SASI_Hs01_00263261 predicted 297
4 SASI_Hs01_00263262 predicted 291
5 SASI_Hs01_00263263 predicted 145
6 SASI_Hs01_00263264 predicted 289
7 SASI_Hs01_00263265 predicted 141
8 SASI_Hs01_00263266 predicted 333
9 SASI_Hs01_00263267 predicted 304
10 SASI_Hs01_00263268 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080446
C11orf94 MISSION shRNA Bacterial Glycerol Stock
chromosome 11 open reading frame 94
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000264048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-196s21c1
Sequence:CCGGTTCCGGCCTGGTGGATGACTACTCGAGTAGTCATCCACCAGGCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-177s21c1
Sequence:CCGGTGGAACTCTCGCAGCCACTTTCTCGAGAAAGTGGCTGCGAGAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-135s21c1
Sequence:CCGGTGAGGTCTCAGCGGTCTGTTCCTCGAGGAACAGACCGCTGAGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-82s21c1
Sequence:CCGGCAGCCTCTTCCTCCACCTCATCTCGAGATGAGGTGGAGGAAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080446
C11orf94 MISSION shRNA shRNA Plasmid DNA
chromosome 11 open reading frame 94
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000264048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-196s21c1
Sequence:CCGGTTCCGGCCTGGTGGATGACTACTCGAGTAGTCATCCACCAGGCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-177s21c1
Sequence:CCGGTGGAACTCTCGCAGCCACTTTCTCGAGAAAGTGGCTGCGAGAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-135s21c1
Sequence:CCGGTGAGGTCTCAGCGGTCTGTTCCTCGAGGAACAGACCGCTGAGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-82s21c1
Sequence:CCGGCAGCCTCTTCCTCCACCTCATCTCGAGATGAGGTGGAGGAAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080446
C11orf94 MISSION shRNA Lentiviral Transduction Particles
chromosome 11 open reading frame 94
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000264048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-196s21c1
Sequence:CCGGTTCCGGCCTGGTGGATGACTACTCGAGTAGTCATCCACCAGGCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-177s21c1
Sequence:CCGGTGGAACTCTCGCAGCCACTTTCTCGAGAAAGTGGCTGCGAGAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-135s21c1
Sequence:CCGGTGAGGTCTCAGCGGTCTGTTCCTCGAGGAACAGACCGCTGAGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080446.2-82s21c1
Sequence:CCGGCAGCCTCTTCCTCCACCTCATCTCGAGATGAGGTGGAGGAAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks