EMAIL THIS PAGE TO A FRIEND

C12orf10

chromosome 12 open reading frame 10

23 Gene Product Result for
Synonyms: Gamm1 MST024 MSTP024 MYG MYG1
UniProtKB ID: Q9HB07
Gene ID:
chicken(426187) chromosome unknown open reading frame, human C12orf10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021640 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097731 MISSION® esiRNA esiRNA human C12orf10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021640 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202207 predicted 739
2 SASI_Hs01_00202208 predicted 353
3 SASI_Hs01_00202209 predicted 704
4 SASI_Hs01_00202211 predicted 509
5 SASI_Hs02_00355000 predicted 209
6 SASI_Hs01_00202212 predicted 372
7 SASI_Hs01_00202213 predicted 692
8 SASI_Hs01_00202214 predicted 831
9 SASI_Hs01_00202215 predicted 679
10 SASI_Hs01_00202216 predicted 601
11 SASI_Hs01_00202210 predicted 639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021640
VALIDATED
C12orf10 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-645s21c1
Sequence:CCGGGAGTTGCTCGACTTAATCCTACTCGAGTAGGATTAAGTCGAGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-363s21c1
Sequence:CCGGGATATGACCATCACCAGAGGTCTCGAGACCTCTGGTGATGGTCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-824s21c1
Sequence:CCGGCCAAGTGGAGAGATTGTGGAACTCGAGTTCCACAATCTCTCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-728s21c1
Sequence:CCGGGAGGAGTTTCTGCAGAGATTACTCGAGTAATCTCTGCAGAAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-613s1c1
Sequence:CCGGGAGTTGCTCGACTTAATCCTACTCGAGTAGGATTAAGTCGAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-696s1c1
Sequence:CCGGGAGGAGTTTCTGCAGAGATTACTCGAGTAATCTCTGCAGAAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-792s1c1
Sequence:CCGGCCAAGTGGAGAGATTGTGGAACTCGAGTTCCACAATCTCTCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-493s1c1
Sequence:CCGGGCACCCTCTATGACAAGATGTCTCGAGACATCTTGTCATAGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.2-351s1c1
Sequence:CCGGGATATGACCATCACCAGAGGTCTCGAGACCTCTGGTGATGGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021640.2-896s1c1
Sequence:CCGGCCAGTGGCCATCTTCTTTGTTCTCGAGAACAAAGAAGATGGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021640
VALIDATED
C12orf10 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-645s21c1
Sequence:CCGGGAGTTGCTCGACTTAATCCTACTCGAGTAGGATTAAGTCGAGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-363s21c1
Sequence:CCGGGATATGACCATCACCAGAGGTCTCGAGACCTCTGGTGATGGTCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-824s21c1
Sequence:CCGGCCAAGTGGAGAGATTGTGGAACTCGAGTTCCACAATCTCTCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-728s21c1
Sequence:CCGGGAGGAGTTTCTGCAGAGATTACTCGAGTAATCTCTGCAGAAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-613s1c1
Sequence:CCGGGAGTTGCTCGACTTAATCCTACTCGAGTAGGATTAAGTCGAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-696s1c1
Sequence:CCGGGAGGAGTTTCTGCAGAGATTACTCGAGTAATCTCTGCAGAAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-792s1c1
Sequence:CCGGCCAAGTGGAGAGATTGTGGAACTCGAGTTCCACAATCTCTCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-493s1c1
Sequence:CCGGGCACCCTCTATGACAAGATGTCTCGAGACATCTTGTCATAGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.2-351s1c1
Sequence:CCGGGATATGACCATCACCAGAGGTCTCGAGACCTCTGGTGATGGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021640.2-896s1c1
Sequence:CCGGCCAGTGGCCATCTTCTTTGTTCTCGAGAACAAAGAAGATGGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021640
VALIDATED
C12orf10 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-645s21c1
Sequence:CCGGGAGTTGCTCGACTTAATCCTACTCGAGTAGGATTAAGTCGAGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-363s21c1
Sequence:CCGGGATATGACCATCACCAGAGGTCTCGAGACCTCTGGTGATGGTCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-824s21c1
Sequence:CCGGCCAAGTGGAGAGATTGTGGAACTCGAGTTCCACAATCTCTCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021640.3-728s21c1
Sequence:CCGGGAGGAGTTTCTGCAGAGATTACTCGAGTAATCTCTGCAGAAACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-613s1c1
Sequence:CCGGGAGTTGCTCGACTTAATCCTACTCGAGTAGGATTAAGTCGAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-696s1c1
Sequence:CCGGGAGGAGTTTCTGCAGAGATTACTCGAGTAATCTCTGCAGAAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-792s1c1
Sequence:CCGGCCAAGTGGAGAGATTGTGGAACTCGAGTTCCACAATCTCTCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.1-493s1c1
Sequence:CCGGGCACCCTCTATGACAAGATGTCTCGAGACATCTTGTCATAGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021640.2-351s1c1
Sequence:CCGGGATATGACCATCACCAGAGGTCTCGAGACCTCTGGTGATGGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021640.2-896s1c1
Sequence:CCGGCCAGTGGCCATCTTCTTTGTTCTCGAGAACAAAGAAGATGGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks