EMAIL THIS PAGE TO A FRIEND

C12orf23

chromosome 12 open reading frame 23

117 Gene Product Result for
Species: Human C12orf23(90488)
UniProtKB ID: Q8WUH6, B3KMN9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152261 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007401 MISSION® esiRNA esiRNA targeting human C12orf23 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152261 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012634 predicted 607
2 SASI_Hs01_00012635 predicted 547
3 SASI_Hs01_00012637 predicted 593
4 SASI_Hs01_00012638 predicted 684
5 SASI_Hs01_00012640 predicted 242
6 SASI_Hs01_00012641 predicted 304
7 SASI_Hs01_00012642 predicted 514
8 SASI_Hs01_00012643 predicted 255
9 SASI_Hs02_00365765 predicted 801
10 SASI_Hs02_00365766 predicted 624
11 SASI_Hs01_00012636 predicted 680
12 SASI_Hs01_00012639 predicted 820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152261
VALIDATED
C12orf23 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 23
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152261.1-962s1c1
Sequence:CCGGCGTACCTTTGATGTGCCTAATCTCGAGATTAGGCACATCAAAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152261.1-278s1c1
Sequence:CCGGGTTCAATGAAAGATCACCCACCTCGAGGTGGGTGATCTTTCATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152261.1-514s1c1
Sequence:CCGGGTTGTAAACAAAGTGCCCTTACTCGAGTAAGGGCACTTTGTTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152261.1-1191s1c1
Sequence:CCGGCCTGAATATGTGCTGTTCTTACTCGAGTAAGAACAGCACATATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152261.1-269s1c1
Sequence:CCGGCACCAGAAGGTTCAATGAAAGCTCGAGCTTTCATTGAACCTTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152261.1-271s1c1
Sequence:CCGGCCAGAAGGTTCAATGAAAGATCTCGAGATCTTTCATTGAACCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152261.1-246s1c1
Sequence:CCGGCCCATCATACCTTAATGATGACTCGAGTCATCATTAAGGTATGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-495s21c1
Sequence:CCGGGGTATCTTCAGTGTTACAAAGCTCGAGCTTTGTAACACTGAAGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-710s21c1
Sequence:CCGGAGACAAATCTGACTGAAATATCTCGAGATATTTCAGTCAGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-402s21c1
Sequence:CCGGGAAATCCCATCATACCTTAATCTCGAGATTAAGGTATGATGGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-662s21c1
Sequence:CCGGTGTTGGGTCTGCTGTTGTAAACTCGAGTTTACAACAGCAGACCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152261
VALIDATED
C12orf23 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 23
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152261.1-962s1c1
Sequence:CCGGCGTACCTTTGATGTGCCTAATCTCGAGATTAGGCACATCAAAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152261.1-278s1c1
Sequence:CCGGGTTCAATGAAAGATCACCCACCTCGAGGTGGGTGATCTTTCATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152261.1-514s1c1
Sequence:CCGGGTTGTAAACAAAGTGCCCTTACTCGAGTAAGGGCACTTTGTTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152261.1-1191s1c1
Sequence:CCGGCCTGAATATGTGCTGTTCTTACTCGAGTAAGAACAGCACATATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152261.1-269s1c1
Sequence:CCGGCACCAGAAGGTTCAATGAAAGCTCGAGCTTTCATTGAACCTTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152261.1-271s1c1
Sequence:CCGGCCAGAAGGTTCAATGAAAGATCTCGAGATCTTTCATTGAACCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152261.1-246s1c1
Sequence:CCGGCCCATCATACCTTAATGATGACTCGAGTCATCATTAAGGTATGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-495s21c1
Sequence:CCGGGGTATCTTCAGTGTTACAAAGCTCGAGCTTTGTAACACTGAAGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-710s21c1
Sequence:CCGGAGACAAATCTGACTGAAATATCTCGAGATATTTCAGTCAGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-402s21c1
Sequence:CCGGGAAATCCCATCATACCTTAATCTCGAGATTAAGGTATGATGGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-662s21c1
Sequence:CCGGTGTTGGGTCTGCTGTTGTAAACTCGAGTTTACAACAGCAGACCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152261
VALIDATED
C12orf23 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 23
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152261.1-962s1c1
Sequence:CCGGCGTACCTTTGATGTGCCTAATCTCGAGATTAGGCACATCAAAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152261.1-278s1c1
Sequence:CCGGGTTCAATGAAAGATCACCCACCTCGAGGTGGGTGATCTTTCATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152261.1-514s1c1
Sequence:CCGGGTTGTAAACAAAGTGCCCTTACTCGAGTAAGGGCACTTTGTTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152261.1-1191s1c1
Sequence:CCGGCCTGAATATGTGCTGTTCTTACTCGAGTAAGAACAGCACATATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152261.1-269s1c1
Sequence:CCGGCACCAGAAGGTTCAATGAAAGCTCGAGCTTTCATTGAACCTTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152261.1-271s1c1
Sequence:CCGGCCAGAAGGTTCAATGAAAGATCTCGAGATCTTTCATTGAACCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152261.1-246s1c1
Sequence:CCGGCCCATCATACCTTAATGATGACTCGAGTCATCATTAAGGTATGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-495s21c1
Sequence:CCGGGGTATCTTCAGTGTTACAAAGCTCGAGCTTTGTAACACTGAAGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-710s21c1
Sequence:CCGGAGACAAATCTGACTGAAATATCTCGAGATATTTCAGTCAGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-402s21c1
Sequence:CCGGGAAATCCCATCATACCTTAATCTCGAGATTAAGGTATGATGGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152261.2-662s21c1
Sequence:CCGGTGTTGGGTCTGCTGTTGTAAACTCGAGTTTACAACAGCAGACCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks