EMAIL THIS PAGE TO A FRIEND

C12orf29

chromosome 12 open reading frame 29

UniProtKB ID: Q8N999, Q569K5, Q6AWA8, Q6PEK5, Q8IYQ5, Q9NT75
Gene ID:
chicken(417886) chromosome 1 open reading frame, human C12orf29
sheep(100528013) chromosome 12 open reading frame 29 ortholog
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009894 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081991 MISSION® esiRNA esiRNA human C12orf29 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009894 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061671 predicted 1098
2 SASI_Hs01_00061672 predicted 1098
3 SASI_Hs01_00061673 predicted 1005
4 SASI_Hs01_00061674 predicted 740
5 SASI_Hs01_00061675 predicted 704
6 SASI_Hs01_00061676 predicted 995
7 SASI_Hs01_00061677 predicted 837
8 SASI_Hs01_00061679 predicted 965
9 SASI_Hs01_00061680 predicted 1088
10 SASI_Hs02_00305703 predicted 1004
11 SASI_Hs01_00061678 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009894
VALIDATED
C12orf29 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 29
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000134598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-614s1c1
Sequence:CCGGGAATTTGAAATTGCCCTGGTACTCGAGTACCAGGGCAATTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-256s1c1
Sequence:CCGGCAAGGCATTAGATGCAGATATCTCGAGATATCTGCATCTAATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009894.1-923s1c1
Sequence:CCGGCATCGCCATCATCTTGGCTTACTCGAGTAAGCCAAGATGATGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001009894.1-946s1c1
Sequence:CCGGCTGGCCAATTCCAGATACTTACTCGAGTAAGTATCTGGAATTGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-248s1c1
Sequence:CCGGGTAAGTCACAAGGCATTAGATCTCGAGATCTAATGCCTTGTGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009894.1-588s1c1
Sequence:CCGGGCTGGCATTCCTCTGTAGTTACTCGAGTAACTACAGAGGAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009894.1-1936s1c1
Sequence:CCGGGCTAGTTAATTCAACTCCCAACTCGAGTTGGGAGTTGAATTAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-701s1c1
Sequence:CCGGGAACAAACACTGGAACTCATACTCGAGTATGAGTTCCAGTGTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-818s1c1
Sequence:CCGGCCTTCATTGAAGCACAATGATCTCGAGATCATTGTGCTTCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009894.1-726s1c1
Sequence:CCGGCAAATATCAATGGAAACCCATCTCGAGATGGGTTTCCATTGATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009894
VALIDATED
C12orf29 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 29
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000134598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-614s1c1
Sequence:CCGGGAATTTGAAATTGCCCTGGTACTCGAGTACCAGGGCAATTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-256s1c1
Sequence:CCGGCAAGGCATTAGATGCAGATATCTCGAGATATCTGCATCTAATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009894.1-923s1c1
Sequence:CCGGCATCGCCATCATCTTGGCTTACTCGAGTAAGCCAAGATGATGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001009894.1-946s1c1
Sequence:CCGGCTGGCCAATTCCAGATACTTACTCGAGTAAGTATCTGGAATTGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-248s1c1
Sequence:CCGGGTAAGTCACAAGGCATTAGATCTCGAGATCTAATGCCTTGTGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009894.1-588s1c1
Sequence:CCGGGCTGGCATTCCTCTGTAGTTACTCGAGTAACTACAGAGGAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009894.1-1936s1c1
Sequence:CCGGGCTAGTTAATTCAACTCCCAACTCGAGTTGGGAGTTGAATTAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-701s1c1
Sequence:CCGGGAACAAACACTGGAACTCATACTCGAGTATGAGTTCCAGTGTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-818s1c1
Sequence:CCGGCCTTCATTGAAGCACAATGATCTCGAGATCATTGTGCTTCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009894.1-726s1c1
Sequence:CCGGCAAATATCAATGGAAACCCATCTCGAGATGGGTTTCCATTGATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009894
VALIDATED
C12orf29 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 29
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000134598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-614s1c1
Sequence:CCGGGAATTTGAAATTGCCCTGGTACTCGAGTACCAGGGCAATTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-256s1c1
Sequence:CCGGCAAGGCATTAGATGCAGATATCTCGAGATATCTGCATCTAATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009894.1-923s1c1
Sequence:CCGGCATCGCCATCATCTTGGCTTACTCGAGTAAGCCAAGATGATGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001009894.1-946s1c1
Sequence:CCGGCTGGCCAATTCCAGATACTTACTCGAGTAAGTATCTGGAATTGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-248s1c1
Sequence:CCGGGTAAGTCACAAGGCATTAGATCTCGAGATCTAATGCCTTGTGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009894.1-588s1c1
Sequence:CCGGGCTGGCATTCCTCTGTAGTTACTCGAGTAACTACAGAGGAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009894.1-1936s1c1
Sequence:CCGGGCTAGTTAATTCAACTCCCAACTCGAGTTGGGAGTTGAATTAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-701s1c1
Sequence:CCGGGAACAAACACTGGAACTCATACTCGAGTATGAGTTCCAGTGTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009894.1-818s1c1
Sequence:CCGGCCTTCATTGAAGCACAATGATCTCGAGATCATTGTGCTTCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009894.1-726s1c1
Sequence:CCGGCAAATATCAATGGAAACCCATCTCGAGATGGGTTTCCATTGATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks