EMAIL THIS PAGE TO A FRIEND

C12orf36

chromosome 12 open reading frame 36

121 Gene Product Result for
Species: Human C12orf36(283422)
UniProtKB ID: Q495D7, Q8N280
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182558 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020851 MISSION® esiRNA esiRNA human C12orf36 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182558 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190018 predicted 1085
2 SASI_Hs01_00190019 predicted 1123
3 SASI_Hs02_00370683 predicted 1131
4 SASI_Hs02_00370684 predicted 1093
5 SASI_Hs01_00190022 predicted 1074
6 SASI_Hs01_00190020 predicted 1113
7 SASI_Hs01_00190021 predicted 1116
8 SASI_Hs01_00190023 predicted 968
9 SASI_Hs01_00190024 predicted 980
10 SASI_Hs02_00370685 predicted 508
11 SASI_Hs01_00190025 predicted 894
12 SASI_Hs01_00190026 predicted 929
13 SASI_Hs01_00190027 predicted 686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182558
C12orf36 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 36
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-449s1c1
Sequence:CCGGCGTAGACACATTCTGCTGGATCTCGAGATCCAGCAGAATGTGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-346s1c1
Sequence:CCGGCTGACCCAGATCAGTTGTTCTCTCGAGAGAACAACTGATCTGGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-542s1c1
Sequence:CCGGGAGTGGACAGACGGCTTTAATCTCGAGATTAAAGCCGTCTGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-485s1c1
Sequence:CCGGCCTGGGAAATCCACTAAGACTCTCGAGAGTCTTAGTGGATTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-496s1c1
Sequence:CCGGCACTAAGACTAGAGGAAAGAACTCGAGTTCTTTCCTCTAGTCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160745    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182558.1-1512s1c1
Sequence:CCGGCCAGTATATTTCTGTGGCTAACTCGAGTTAGCCACAGAAATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-510s1c1
Sequence:CCGGGAAAGAATTGCTTGGAGGATTCTCGAGAATCCTCCAAGCAATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182558.1-1772s1c1
Sequence:CCGGCCTCAGATTCAAACACAGTTTCTCGAGAAACTGTGTTTGAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-303s1c1
Sequence:CCGGGACACTTCATGCTCCACTATTCTCGAGAATAGTGGAGCATGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-398s1c1
Sequence:CCGGGAGCAACAGATTTGGGAATGACTCGAGTCATTCCCAAATCTGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182558
C12orf36 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 36
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-449s1c1
Sequence:CCGGCGTAGACACATTCTGCTGGATCTCGAGATCCAGCAGAATGTGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-346s1c1
Sequence:CCGGCTGACCCAGATCAGTTGTTCTCTCGAGAGAACAACTGATCTGGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-542s1c1
Sequence:CCGGGAGTGGACAGACGGCTTTAATCTCGAGATTAAAGCCGTCTGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-485s1c1
Sequence:CCGGCCTGGGAAATCCACTAAGACTCTCGAGAGTCTTAGTGGATTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-496s1c1
Sequence:CCGGCACTAAGACTAGAGGAAAGAACTCGAGTTCTTTCCTCTAGTCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160745    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182558.1-1512s1c1
Sequence:CCGGCCAGTATATTTCTGTGGCTAACTCGAGTTAGCCACAGAAATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-510s1c1
Sequence:CCGGGAAAGAATTGCTTGGAGGATTCTCGAGAATCCTCCAAGCAATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182558.1-1772s1c1
Sequence:CCGGCCTCAGATTCAAACACAGTTTCTCGAGAAACTGTGTTTGAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-303s1c1
Sequence:CCGGGACACTTCATGCTCCACTATTCTCGAGAATAGTGGAGCATGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-398s1c1
Sequence:CCGGGAGCAACAGATTTGGGAATGACTCGAGTCATTCCCAAATCTGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182558
C12orf36 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 36
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-449s1c1
Sequence:CCGGCGTAGACACATTCTGCTGGATCTCGAGATCCAGCAGAATGTGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-346s1c1
Sequence:CCGGCTGACCCAGATCAGTTGTTCTCTCGAGAGAACAACTGATCTGGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-542s1c1
Sequence:CCGGGAGTGGACAGACGGCTTTAATCTCGAGATTAAAGCCGTCTGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-485s1c1
Sequence:CCGGCCTGGGAAATCCACTAAGACTCTCGAGAGTCTTAGTGGATTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-496s1c1
Sequence:CCGGCACTAAGACTAGAGGAAAGAACTCGAGTTCTTTCCTCTAGTCTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160745    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182558.1-1512s1c1
Sequence:CCGGCCAGTATATTTCTGTGGCTAACTCGAGTTAGCCACAGAAATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-510s1c1
Sequence:CCGGGAAAGAATTGCTTGGAGGATTCTCGAGAATCCTCCAAGCAATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182558.1-1772s1c1
Sequence:CCGGCCTCAGATTCAAACACAGTTTCTCGAGAAACTGTGTTTGAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-303s1c1
Sequence:CCGGGACACTTCATGCTCCACTATTCTCGAGAATAGTGGAGCATGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182558.1-398s1c1
Sequence:CCGGGAGCAACAGATTTGGGAATGACTCGAGTCATTCCCAAATCTGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks