EMAIL THIS PAGE TO A FRIEND

C12orf39

chromosome 12 open reading frame 39

17 Gene Product Result for
Species: Human C12orf39(80763)
UniProtKB ID: Q9BT56, B3KND6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012890 Anti-C12orf39 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030572 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026421 MISSION® esiRNA esiRNA human C12orf39 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030572 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196552 predicted 353
2 SASI_Hs02_00358140 predicted 232
3 SASI_Hs01_00196553 predicted 297
4 SASI_Hs01_00196554 predicted 338
5 SASI_Hs01_00196555 predicted 294
6 SASI_Hs01_00196556 predicted 296
7 SASI_Hs01_00196557 predicted 256
8 SASI_Hs01_00196558 predicted 252
9 SASI_Hs01_00196559 predicted 224
10 SASI_Hs01_00196560 predicted 332
11 SASI_Hs01_00196551 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030572
C12orf39 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 39
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-475s1c1
Sequence:CCGGCCTGGAAGACAGTCTGCTTAACTCGAGTTAAGCAGACTGTCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-457s1c1
Sequence:CCGGCTTTGATCAAACCAGATTCCTCTCGAGAGGAATCTGGTTTGATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-425s1c1
Sequence:CCGGCTTCAGAAATCACCAGAAGATCTCGAGATCTTCTGGTGATTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-256s1c1
Sequence:CCGGGAACTGGACTCCTCAAGCTATCTCGAGATAGCTTGAGGAGTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-421s1c1
Sequence:CCGGGTCCCTTCAGAAATCACCAGACTCGAGTCTGGTGATTTCTGAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-262s1c1
Sequence:CCGGGACTCCTCAAGCTATGCTCTACTCGAGTAGAGCATAGCTTGAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030572.2-356s21c1
Sequence:CCGGCCGGAAAGACGAAGCCCAAATCTCGAGATTTGGGCTTCGTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030572.2-397s21c1
Sequence:CCGGGGAGGCAGCAACCATCTTACTCTCGAGAGTAAGATGGTTGCTGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030572.2-409s21c1
Sequence:CCGGCATCTTACTGGCGTCCCTTCACTCGAGTGAAGGGACGCCAGTAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030572
C12orf39 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 39
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-475s1c1
Sequence:CCGGCCTGGAAGACAGTCTGCTTAACTCGAGTTAAGCAGACTGTCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-457s1c1
Sequence:CCGGCTTTGATCAAACCAGATTCCTCTCGAGAGGAATCTGGTTTGATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-425s1c1
Sequence:CCGGCTTCAGAAATCACCAGAAGATCTCGAGATCTTCTGGTGATTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-256s1c1
Sequence:CCGGGAACTGGACTCCTCAAGCTATCTCGAGATAGCTTGAGGAGTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-421s1c1
Sequence:CCGGGTCCCTTCAGAAATCACCAGACTCGAGTCTGGTGATTTCTGAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-262s1c1
Sequence:CCGGGACTCCTCAAGCTATGCTCTACTCGAGTAGAGCATAGCTTGAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030572.2-356s21c1
Sequence:CCGGCCGGAAAGACGAAGCCCAAATCTCGAGATTTGGGCTTCGTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030572.2-397s21c1
Sequence:CCGGGGAGGCAGCAACCATCTTACTCTCGAGAGTAAGATGGTTGCTGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030572.2-409s21c1
Sequence:CCGGCATCTTACTGGCGTCCCTTCACTCGAGTGAAGGGACGCCAGTAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030572
C12orf39 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 39
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-475s1c1
Sequence:CCGGCCTGGAAGACAGTCTGCTTAACTCGAGTTAAGCAGACTGTCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-457s1c1
Sequence:CCGGCTTTGATCAAACCAGATTCCTCTCGAGAGGAATCTGGTTTGATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-425s1c1
Sequence:CCGGCTTCAGAAATCACCAGAAGATCTCGAGATCTTCTGGTGATTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-256s1c1
Sequence:CCGGGAACTGGACTCCTCAAGCTATCTCGAGATAGCTTGAGGAGTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-421s1c1
Sequence:CCGGGTCCCTTCAGAAATCACCAGACTCGAGTCTGGTGATTTCTGAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030572.1-262s1c1
Sequence:CCGGGACTCCTCAAGCTATGCTCTACTCGAGTAGAGCATAGCTTGAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030572.2-356s21c1
Sequence:CCGGCCGGAAAGACGAAGCCCAAATCTCGAGATTTGGGCTTCGTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030572.2-397s21c1
Sequence:CCGGGGAGGCAGCAACCATCTTACTCTCGAGAGTAAGATGGTTGCTGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030572.2-409s21c1
Sequence:CCGGCATCTTACTGGCGTCCCTTCACTCGAGTGAAGGGACGCCAGTAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks