EMAIL THIS PAGE TO A FRIEND

C12orf40

chromosome 12 open reading frame 40

53 Gene Product Result for
Species: Human C12orf40(283461)
UniProtKB ID: Q86WS4, B7WNU1, Q8IXY6, Q8N818
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173599 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072781 MISSION® esiRNA esiRNA human C12orf4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031748 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013851 predicted 1027
2 SASI_Hs01_00013852 predicted 1133
3 SASI_Hs02_00307808 predicted 1950
4 SASI_Hs01_00013853 predicted 1995
5 SASI_Hs02_00307809 predicted 1489
6 SASI_Hs01_00013854 predicted 1934
7 SASI_Hs01_00013855 predicted 1143
8 SASI_Hs01_00013857 predicted 1119
9 SASI_Hs01_00013858 predicted 543
10 SASI_Hs01_00013859 predicted 837
11 SASI_Hs01_00013850 predicted 636
12 SASI_Hs01_00013856 predicted 1524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173599
C12orf40 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 40
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173599.1-1254s1c1
Sequence:CCGGCAGCAAACTCTATCTGGTGTACTCGAGTACACCAGATAGAGTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173599.1-1752s1c1
Sequence:CCGGCCACACAAAGATTGACAGTAACTCGAGTTACTGTCAATCTTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173599.1-2410s1c1
Sequence:CCGGCCCATTACTTTGGAAATAGAACTCGAGTTCTATTTCCAAAGTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173599.1-2475s1c1
Sequence:CCGGCCTGTGAAACAGGAAGCTAAACTCGAGTTTAGCTTCCTGTTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173599.1-963s1c1
Sequence:CCGGGAGATACTTGTGTAGTCACTACTCGAGTAGTGACTACACAAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173599.1-512s1c1
Sequence:CCGGCCTCAGAAACTTGCATATGAACTCGAGTTCATATGCAAGTTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173599.1-1102s1c1
Sequence:CCGGCAAGAAGTATCAGAGAGAGTACTCGAGTACTCTCTCTGATACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173599.1-424s1c1
Sequence:CCGGCAGTTTCACTCCATCATCTTTCTCGAGAAAGATGATGGAGTGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173599.1-326s1c1
Sequence:CCGGCAAAGACTAAGTAGCAAGGAACTCGAGTTCCTTGCTACTTAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173599
C12orf40 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 40
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173599.1-1254s1c1
Sequence:CCGGCAGCAAACTCTATCTGGTGTACTCGAGTACACCAGATAGAGTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173599.1-1752s1c1
Sequence:CCGGCCACACAAAGATTGACAGTAACTCGAGTTACTGTCAATCTTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173599.1-2410s1c1
Sequence:CCGGCCCATTACTTTGGAAATAGAACTCGAGTTCTATTTCCAAAGTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173599.1-2475s1c1
Sequence:CCGGCCTGTGAAACAGGAAGCTAAACTCGAGTTTAGCTTCCTGTTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173599.1-963s1c1
Sequence:CCGGGAGATACTTGTGTAGTCACTACTCGAGTAGTGACTACACAAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173599.1-512s1c1
Sequence:CCGGCCTCAGAAACTTGCATATGAACTCGAGTTCATATGCAAGTTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173599.1-1102s1c1
Sequence:CCGGCAAGAAGTATCAGAGAGAGTACTCGAGTACTCTCTCTGATACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173599.1-424s1c1
Sequence:CCGGCAGTTTCACTCCATCATCTTTCTCGAGAAAGATGATGGAGTGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173599.1-326s1c1
Sequence:CCGGCAAAGACTAAGTAGCAAGGAACTCGAGTTCCTTGCTACTTAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173599
C12orf40 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 40
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173599.1-1254s1c1
Sequence:CCGGCAGCAAACTCTATCTGGTGTACTCGAGTACACCAGATAGAGTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173599.1-1752s1c1
Sequence:CCGGCCACACAAAGATTGACAGTAACTCGAGTTACTGTCAATCTTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173599.1-2410s1c1
Sequence:CCGGCCCATTACTTTGGAAATAGAACTCGAGTTCTATTTCCAAAGTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173599.1-2475s1c1
Sequence:CCGGCCTGTGAAACAGGAAGCTAAACTCGAGTTTAGCTTCCTGTTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173599.1-963s1c1
Sequence:CCGGGAGATACTTGTGTAGTCACTACTCGAGTAGTGACTACACAAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173599.1-512s1c1
Sequence:CCGGCCTCAGAAACTTGCATATGAACTCGAGTTCATATGCAAGTTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173599.1-1102s1c1
Sequence:CCGGCAAGAAGTATCAGAGAGAGTACTCGAGTACTCTCTCTGATACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173599.1-424s1c1
Sequence:CCGGCAGTTTCACTCCATCATCTTTCTCGAGAAAGATGATGGAGTGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173599.1-326s1c1
Sequence:CCGGCAAAGACTAAGTAGCAAGGAACTCGAGTTCCTTGCTACTTAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks