EMAIL THIS PAGE TO A FRIEND

C12orf42

chromosome 12 open reading frame 42

37 Gene Product Result for
Species: Human C12orf42(374470)
UniProtKB ID: Q96LP6, Q49A64, Q4G0S2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198521 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022011 MISSION® esiRNA esiRNA human C12orf42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099336 Rosetta Predictions human pricing
NM_198521 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320489 predicted 921
2 SASI_Hs02_00320490 predicted 766
3 SASI_Hs02_00320491 predicted 738
4 SASI_Hs02_00320492 predicted 849
5 SASI_Hs02_00320493 predicted 686
6 SASI_Hs02_00320494 predicted 522
7 SASI_Hs02_00320495 predicted 868
8 SASI_Hs02_00320496 predicted 696
9 SASI_Hs02_00320497 predicted 448
10 SASI_Hs02_00320498 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229559 predicted 777
2 SASI_Hs01_00229560 predicted 632
3 SASI_Hs01_00229561 predicted 599
4 SASI_Hs02_00372099 predicted 717
5 SASI_Hs01_00229563 predicted 554
6 SASI_Hs01_00229565 predicted 382
7 SASI_Hs02_00372100 predicted 728
8 SASI_Hs02_00372101 predicted 552
9 SASI_Hs01_00229562 predicted 311
10 SASI_Hs01_00229564 predicted 319
11 SASI_Hs01_00229566 predicted 1103
12 SASI_Hs01_00229567 predicted 270
13 SASI_Hs01_00229568 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198521
C12orf42 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 42
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198521.1-273s1c1
Sequence:CCGGCCAGATTCATTAATCACATGACTCGAGTCATGTGATTAATGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198521.1-242s1c1
Sequence:CCGGCCTTGTTATGAAAGAACTTCACTCGAGTGAAGTTCTTTCATAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-264s21c1
Sequence:CCGGTACCCTGCTCCAGATTCATTACTCGAGTAATGAATCTGGAGCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-1150s21c1
Sequence:CCGGGGTGAATGCTCACTTACATTGCTCGAGCAATGTAAGTGAGCATTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-566s21c1
Sequence:CCGGCAGGCTTGGAACAGTTCATTTCTCGAGAAATGAACTGTTCCAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-610s21c1
Sequence:CCGGTAACTGGGCACACTCAGTAAACTCGAGTTTACTGAGTGTGCCCAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-298s21c1
Sequence:CCGGTTTCTCTGAATCTCCTAAATTCTCGAGAATTTAGGAGATTCAGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198521
C12orf42 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 42
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198521.1-273s1c1
Sequence:CCGGCCAGATTCATTAATCACATGACTCGAGTCATGTGATTAATGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198521.1-242s1c1
Sequence:CCGGCCTTGTTATGAAAGAACTTCACTCGAGTGAAGTTCTTTCATAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-264s21c1
Sequence:CCGGTACCCTGCTCCAGATTCATTACTCGAGTAATGAATCTGGAGCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-1150s21c1
Sequence:CCGGGGTGAATGCTCACTTACATTGCTCGAGCAATGTAAGTGAGCATTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-566s21c1
Sequence:CCGGCAGGCTTGGAACAGTTCATTTCTCGAGAAATGAACTGTTCCAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-610s21c1
Sequence:CCGGTAACTGGGCACACTCAGTAAACTCGAGTTTACTGAGTGTGCCCAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-298s21c1
Sequence:CCGGTTTCTCTGAATCTCCTAAATTCTCGAGAATTTAGGAGATTCAGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198521
C12orf42 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 42
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198521.1-273s1c1
Sequence:CCGGCCAGATTCATTAATCACATGACTCGAGTCATGTGATTAATGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198521.1-242s1c1
Sequence:CCGGCCTTGTTATGAAAGAACTTCACTCGAGTGAAGTTCTTTCATAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-264s21c1
Sequence:CCGGTACCCTGCTCCAGATTCATTACTCGAGTAATGAATCTGGAGCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-1150s21c1
Sequence:CCGGGGTGAATGCTCACTTACATTGCTCGAGCAATGTAAGTGAGCATTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-566s21c1
Sequence:CCGGCAGGCTTGGAACAGTTCATTTCTCGAGAAATGAACTGTTCCAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-610s21c1
Sequence:CCGGTAACTGGGCACACTCAGTAAACTCGAGTTTACTGAGTGTGCCCAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198521.2-298s21c1
Sequence:CCGGTTTCTCTGAATCTCCTAAATTCTCGAGAATTTAGGAGATTCAGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks