EMAIL THIS PAGE TO A FRIEND

C12orf43

chromosome 12 open reading frame 43

UniProtKB ID: Q96C57, Q53HF0, Q9H9Z7
Gene ID:
chicken(416966) chromosome 15 open reading frame, human C12orf43
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022895 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132381 MISSION® esiRNA esiRNA human C12orf43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022895 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072780 predicted 950
2 SASI_Hs01_00072781 predicted 360
3 SASI_Hs01_00072782 predicted 778
4 SASI_Hs01_00072783 predicted 1298
5 SASI_Hs01_00072784 predicted 1091
6 SASI_Hs01_00072785 predicted 1295
7 SASI_Hs01_00072786 predicted 948
8 SASI_Hs01_00072787 predicted 937
9 SASI_Hs01_00072788 predicted 790
10 SASI_Hs01_00072789 predicted 204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022895
VALIDATED
C12orf43 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 43
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_022895.1-1059s21c1
Sequence:CCGGCGCTGTGGTTCCAGAACATTTCTCGAGAAATGTTCTGGAACCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022895.1-781s21c1
Sequence:CCGGCAAAGAGTGCTACAGCTATACCTCGAGGTATAGCTGTAGCACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022895.1-231s21c1
Sequence:CCGGGAACAAGATGGCAACGAGCTTCTCGAGAAGCTCGTTGCCATCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022895.1-219s21c1
Sequence:CCGGGTGAATGAGCATGAACAAGATCTCGAGATCTTGTTCATGCTCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022895.1-1102s1c1
Sequence:CCGGCCTTCCAGTTATTTGAGACTACTCGAGTAGTCTCAAATAACTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022895.1-231s1c1
Sequence:CCGGGAACAAGATGGCAACGAGCTTCTCGAGAAGCTCGTTGCCATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022895.1-362s1c1
Sequence:CCGGGAAAGTCGCTTTGGAGGATGACTCGAGTCATCCTCCAAAGCGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022895.1-219s1c1
Sequence:CCGGGTGAATGAGCATGAACAAGATCTCGAGATCTTGTTCATGCTCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022895.1-55s1c1
Sequence:CCGGCGGAAAGTAGTAACAGCAGTACTCGAGTACTGCTGTTACTACTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022895
VALIDATED
C12orf43 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 43
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_022895.1-1059s21c1
Sequence:CCGGCGCTGTGGTTCCAGAACATTTCTCGAGAAATGTTCTGGAACCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022895.1-781s21c1
Sequence:CCGGCAAAGAGTGCTACAGCTATACCTCGAGGTATAGCTGTAGCACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022895.1-231s21c1
Sequence:CCGGGAACAAGATGGCAACGAGCTTCTCGAGAAGCTCGTTGCCATCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022895.1-219s21c1
Sequence:CCGGGTGAATGAGCATGAACAAGATCTCGAGATCTTGTTCATGCTCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022895.1-1102s1c1
Sequence:CCGGCCTTCCAGTTATTTGAGACTACTCGAGTAGTCTCAAATAACTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022895.1-231s1c1
Sequence:CCGGGAACAAGATGGCAACGAGCTTCTCGAGAAGCTCGTTGCCATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022895.1-362s1c1
Sequence:CCGGGAAAGTCGCTTTGGAGGATGACTCGAGTCATCCTCCAAAGCGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022895.1-219s1c1
Sequence:CCGGGTGAATGAGCATGAACAAGATCTCGAGATCTTGTTCATGCTCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022895.1-55s1c1
Sequence:CCGGCGGAAAGTAGTAACAGCAGTACTCGAGTACTGCTGTTACTACTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022895
VALIDATED
C12orf43 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 43
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_022895.1-1059s21c1
Sequence:CCGGCGCTGTGGTTCCAGAACATTTCTCGAGAAATGTTCTGGAACCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022895.1-781s21c1
Sequence:CCGGCAAAGAGTGCTACAGCTATACCTCGAGGTATAGCTGTAGCACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_022895.1-231s21c1
Sequence:CCGGGAACAAGATGGCAACGAGCTTCTCGAGAAGCTCGTTGCCATCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022895.1-219s21c1
Sequence:CCGGGTGAATGAGCATGAACAAGATCTCGAGATCTTGTTCATGCTCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022895.1-1102s1c1
Sequence:CCGGCCTTCCAGTTATTTGAGACTACTCGAGTAGTCTCAAATAACTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022895.1-231s1c1
Sequence:CCGGGAACAAGATGGCAACGAGCTTCTCGAGAAGCTCGTTGCCATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022895.1-362s1c1
Sequence:CCGGGAAAGTCGCTTTGGAGGATGACTCGAGTCATCCTCCAAAGCGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022895.1-219s1c1
Sequence:CCGGGTGAATGAGCATGAACAAGATCTCGAGATCTTGTTCATGCTCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_022895.1-55s1c1
Sequence:CCGGCGGAAAGTAGTAACAGCAGTACTCGAGTACTGCTGTTACTACTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks