EMAIL THIS PAGE TO A FRIEND

C12orf44

chromosome 12 open reading frame 44

67 Gene Product Result for
Synonyms: ATG101
Species: Human C12orf44(60673)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021934 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086061 MISSION® esiRNA esiRNA human C12orf44 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098673 Rosetta Predictions human pricing
NM_021934 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319721 predicted 744
2 SASI_Hs02_00319722 predicted 468
3 SASI_Hs02_00319723 predicted 467
4 SASI_Hs02_00319724 predicted 720
5 SASI_Hs02_00319725 predicted 397
6 SASI_Hs02_00319726 predicted 731
7 SASI_Hs02_00319727 predicted 669
8 SASI_Hs02_00319728 predicted 805
9 SASI_Hs02_00319729 predicted 949
10 SASI_Hs02_00319730 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018504 predicted 918
2 SASI_Hs01_00018505 predicted 634
3 SASI_Hs01_00018506 predicted 645
4 SASI_Hs02_00355231 predicted 896
5 SASI_Hs01_00018507 predicted 571
6 SASI_Hs01_00018509 predicted 900
7 SASI_Hs01_00018510 predicted 837
8 SASI_Hs01_00018511 predicted 978
9 SASI_Hs02_00355232 predicted 1117
10 SASI_Hs01_00018512 predicted 892
11 SASI_Hs01_00018508 predicted 862
12 SASI_Hs01_00018513 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021934
C12orf44 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 44
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-532s1c1
Sequence:CCGGCAAGTTCCACTACAAGAAGGACTCGAGTCCTTCTTGTAGTGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-583s1c1
Sequence:CCGGCCAGGATGTTGACTGTGACTTCTCGAGAAGTCACAGTCAACATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-987s1c1
Sequence:CCGGCCTACCTGTACAAGATCTCCTCTCGAGAGGAGATCTTGTACAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-607s1c1
Sequence:CCGGCGACTTCACTTATGTGCGTGTCTCGAGACACGCACATAAGTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-715s1c1
Sequence:CCGGGCAGATGTCCTTGGAGTTCTACTCGAGTAGAACTCCAAGGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-584s1c1
Sequence:CCGGCAGGATGTTGACTGTGACTTCCTCGAGGAAGTCACAGTCAACATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-883s1c1
Sequence:CCGGCATCAACATCGTGGAGGTGATCTCGAGATCACCTCCACGATGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-526s1c1
Sequence:CCGGCACAGGCAAGTTCCACTACAACTCGAGTTGTAGTGGAACTTGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-871s1c1
Sequence:CCGGCTGCGAGAAGATCATCAACATCTCGAGATGTTGATGATCTTCTCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-599s1c1
Sequence:CCGGGACTTCATCGACTTCACTTATCTCGAGATAAGTGAAGTCGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021934
C12orf44 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 44
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-532s1c1
Sequence:CCGGCAAGTTCCACTACAAGAAGGACTCGAGTCCTTCTTGTAGTGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-583s1c1
Sequence:CCGGCCAGGATGTTGACTGTGACTTCTCGAGAAGTCACAGTCAACATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-987s1c1
Sequence:CCGGCCTACCTGTACAAGATCTCCTCTCGAGAGGAGATCTTGTACAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-607s1c1
Sequence:CCGGCGACTTCACTTATGTGCGTGTCTCGAGACACGCACATAAGTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-715s1c1
Sequence:CCGGGCAGATGTCCTTGGAGTTCTACTCGAGTAGAACTCCAAGGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-584s1c1
Sequence:CCGGCAGGATGTTGACTGTGACTTCCTCGAGGAAGTCACAGTCAACATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-883s1c1
Sequence:CCGGCATCAACATCGTGGAGGTGATCTCGAGATCACCTCCACGATGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-526s1c1
Sequence:CCGGCACAGGCAAGTTCCACTACAACTCGAGTTGTAGTGGAACTTGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-871s1c1
Sequence:CCGGCTGCGAGAAGATCATCAACATCTCGAGATGTTGATGATCTTCTCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-599s1c1
Sequence:CCGGGACTTCATCGACTTCACTTATCTCGAGATAAGTGAAGTCGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021934
C12orf44 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 44
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-532s1c1
Sequence:CCGGCAAGTTCCACTACAAGAAGGACTCGAGTCCTTCTTGTAGTGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-583s1c1
Sequence:CCGGCCAGGATGTTGACTGTGACTTCTCGAGAAGTCACAGTCAACATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-987s1c1
Sequence:CCGGCCTACCTGTACAAGATCTCCTCTCGAGAGGAGATCTTGTACAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-607s1c1
Sequence:CCGGCGACTTCACTTATGTGCGTGTCTCGAGACACGCACATAAGTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-715s1c1
Sequence:CCGGGCAGATGTCCTTGGAGTTCTACTCGAGTAGAACTCCAAGGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-584s1c1
Sequence:CCGGCAGGATGTTGACTGTGACTTCCTCGAGGAAGTCACAGTCAACATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021934.3-883s1c1
Sequence:CCGGCATCAACATCGTGGAGGTGATCTCGAGATCACCTCCACGATGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-526s1c1
Sequence:CCGGCACAGGCAAGTTCCACTACAACTCGAGTTGTAGTGGAACTTGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-871s1c1
Sequence:CCGGCTGCGAGAAGATCATCAACATCTCGAGATGTTGATGATCTTCTCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021934.3-599s1c1
Sequence:CCGGGACTTCATCGACTTCACTTATCTCGAGATAAGTGAAGTCGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks