EMAIL THIS PAGE TO A FRIEND

C12orf45

chromosome 12 open reading frame 45

19 Gene Product Result for
UniProtKB ID: Q8N5I9
Gene ID:
chicken(418079) chromosome 1 open reading frame, human C12orf45
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038722 Anti-C12orf45 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152318 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046591 MISSION® esiRNA esiRNA human C12orf45 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152318 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018294 predicted 337
2 SASI_Hs01_00018295 predicted 253
3 SASI_Hs01_00018296 predicted 255
4 SASI_Hs01_00018298 predicted 308
5 SASI_Hs01_00018299 predicted 340
6 SASI_Hs01_00018301 predicted 226
7 SASI_Hs02_00365905 predicted 316
8 SASI_Hs02_00365906 predicted 317
9 SASI_Hs01_00018302 predicted 229
10 SASI_Hs01_00018303 predicted 213
11 SASI_Hs01_00018297 predicted 204
12 SASI_Hs01_00018300 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152318
VALIDATED
C12orf45 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 45
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-327s1c1
Sequence:CCGGGATGGGCCTCATAGTAAAGTTCTCGAGAACTTTACTATGAGGCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152318.1-158s1c1
Sequence:CCGGCTCCCAACCTAAGTCCAGAAACTCGAGTTTCTGGACTTAGGTTGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-160s1c1
Sequence:CCGGCCCAACCTAAGTCCAGAAAGACTCGAGTCTTTCTGGACTTAGGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-360s1c1
Sequence:CCGGGTGGCTTTGTTTGAGATGAATCTCGAGATTCATCTCAAACAAAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152318.1-402s1c1
Sequence:CCGGGACAGTTCAGAAGAGAGTTCACTCGAGTGAACTCTCTTCTGAACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152318.1-300s1c1
Sequence:CCGGCCTGGTCGTTTCAATATTGAACTCGAGTTCAATATTGAAACGACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152318.1-185s1c1
Sequence:CCGGCACTCTTCAAACAGTTCGGATCTCGAGATCCGAACTGTTTGAAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-414s1c1
Sequence:CCGGGAGAGTTCACAAGACAGTTCACTCGAGTGAACTGTCTTGTGAACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-316s21c1
Sequence:CCGGCCTGGTCGTTTCAATATTGAACTCGAGTTCAATATTGAAACGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-430s21c1
Sequence:CCGGGAGAGTTCACAAGACAGTTCACTCGAGTGAACTGTCTTGTGAACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-376s21c1
Sequence:CCGGGTGGCTTTGTTTGAGATGAATCTCGAGATTCATCTCAAACAAAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-343s21c1
Sequence:CCGGGATGGGCCTCATAGTAAAGTTCTCGAGAACTTTACTATGAGGCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152318
VALIDATED
C12orf45 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 45
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-327s1c1
Sequence:CCGGGATGGGCCTCATAGTAAAGTTCTCGAGAACTTTACTATGAGGCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152318.1-158s1c1
Sequence:CCGGCTCCCAACCTAAGTCCAGAAACTCGAGTTTCTGGACTTAGGTTGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-160s1c1
Sequence:CCGGCCCAACCTAAGTCCAGAAAGACTCGAGTCTTTCTGGACTTAGGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-360s1c1
Sequence:CCGGGTGGCTTTGTTTGAGATGAATCTCGAGATTCATCTCAAACAAAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152318.1-402s1c1
Sequence:CCGGGACAGTTCAGAAGAGAGTTCACTCGAGTGAACTCTCTTCTGAACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152318.1-300s1c1
Sequence:CCGGCCTGGTCGTTTCAATATTGAACTCGAGTTCAATATTGAAACGACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152318.1-185s1c1
Sequence:CCGGCACTCTTCAAACAGTTCGGATCTCGAGATCCGAACTGTTTGAAGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-414s1c1
Sequence:CCGGGAGAGTTCACAAGACAGTTCACTCGAGTGAACTGTCTTGTGAACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-316s21c1
Sequence:CCGGCCTGGTCGTTTCAATATTGAACTCGAGTTCAATATTGAAACGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-430s21c1
Sequence:CCGGGAGAGTTCACAAGACAGTTCACTCGAGTGAACTGTCTTGTGAACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-376s21c1
Sequence:CCGGGTGGCTTTGTTTGAGATGAATCTCGAGATTCATCTCAAACAAAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-343s21c1
Sequence:CCGGGATGGGCCTCATAGTAAAGTTCTCGAGAACTTTACTATGAGGCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152318
VALIDATED
C12orf45 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 45
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-327s1c1
Sequence:CCGGGATGGGCCTCATAGTAAAGTTCTCGAGAACTTTACTATGAGGCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152318.1-158s1c1
Sequence:CCGGCTCCCAACCTAAGTCCAGAAACTCGAGTTTCTGGACTTAGGTTGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-160s1c1
Sequence:CCGGCCCAACCTAAGTCCAGAAAGACTCGAGTCTTTCTGGACTTAGGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-360s1c1
Sequence:CCGGGTGGCTTTGTTTGAGATGAATCTCGAGATTCATCTCAAACAAAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152318.1-402s1c1
Sequence:CCGGGACAGTTCAGAAGAGAGTTCACTCGAGTGAACTCTCTTCTGAACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152318.1-300s1c1
Sequence:CCGGCCTGGTCGTTTCAATATTGAACTCGAGTTCAATATTGAAACGACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152318.1-185s1c1
Sequence:CCGGCACTCTTCAAACAGTTCGGATCTCGAGATCCGAACTGTTTGAAGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152318.1-414s1c1
Sequence:CCGGGAGAGTTCACAAGACAGTTCACTCGAGTGAACTGTCTTGTGAACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-316s21c1
Sequence:CCGGCCTGGTCGTTTCAATATTGAACTCGAGTTCAATATTGAAACGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-430s21c1
Sequence:CCGGGAGAGTTCACAAGACAGTTCACTCGAGTGAACTGTCTTGTGAACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-376s21c1
Sequence:CCGGGTGGCTTTGTTTGAGATGAATCTCGAGATTCATCTCAAACAAAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152318.2-343s21c1
Sequence:CCGGGATGGGCCTCATAGTAAAGTTCTCGAGAACTTTACTATGAGGCCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)