EMAIL THIS PAGE TO A FRIEND

C12orf49

chromosome 12 open reading frame 49

19 Gene Product Result for
Species: Human C12orf49(79794)
UniProtKB ID: Q9H741, Q53GE8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024738 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110511 MISSION® esiRNA esiRNA human C12orf49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024738 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056655 predicted 379
2 SASI_Hs01_00056656 predicted 923
3 SASI_Hs01_00056657 predicted 1196
4 SASI_Hs01_00056658 predicted 660
5 SASI_Hs01_00056659 predicted 980
6 SASI_Hs01_00056660 predicted 389
7 SASI_Hs01_00056661 predicted 423
8 SASI_Hs01_00056662 predicted 849
9 SASI_Hs01_00056663 predicted 355
10 SASI_Hs01_00056664 predicted 1153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024738
VALIDATED
C12orf49 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 49
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-396s21c1
Sequence:CCGGGGATGAACTCGGCTACGTTTGCTCGAGCAAACGTAGCCGAGTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-635s21c1
Sequence:CCGGTTGAGTTGTGCCTGGCCAAATCTCGAGATTTGGCCAGGCACAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-433s21c1
Sequence:CCGGCTGGTAAATGGCTGCTGTAATCTCGAGATTACAGCAGCCATTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-281s21c1
Sequence:CCGGTCCAGGTTCATGACCATAATCCTCGAGGATTATGGTCATGAACCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-321s21c1
Sequence:CCGGGCAGTTTAACTTGGGCAATAGCTCGAGCTATTGCCCAAGTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-356s21c1
Sequence:CCGGATCAGTGCCGCAACTCCATTCCTCGAGGAATGGAGTTGCGGCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024738.1-1199s1c1
Sequence:CCGGGCCATTCTAGTTGAATATGTTCTCGAGAACATATTCAACTAGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024738.1-703s1c1
Sequence:CCGGCCCATAGCAAAGTATTGCTATCTCGAGATAGCAATACTTTGCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024738.1-446s1c1
Sequence:CCGGGCTGTAATGTCAACGTCCCTACTCGAGTAGGGACGTTGACATTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024738.1-420s1c1
Sequence:CCGGGAGGAAGGATTTGCTGGTAAACTCGAGTTTACCAGCAAATCCTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024738.1-319s1c1
Sequence:CCGGGTGCAGTTTAACTTGGGCAATCTCGAGATTGCCCAAGTTAAACTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024738
VALIDATED
C12orf49 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 49
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-396s21c1
Sequence:CCGGGGATGAACTCGGCTACGTTTGCTCGAGCAAACGTAGCCGAGTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-635s21c1
Sequence:CCGGTTGAGTTGTGCCTGGCCAAATCTCGAGATTTGGCCAGGCACAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-433s21c1
Sequence:CCGGCTGGTAAATGGCTGCTGTAATCTCGAGATTACAGCAGCCATTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-281s21c1
Sequence:CCGGTCCAGGTTCATGACCATAATCCTCGAGGATTATGGTCATGAACCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-321s21c1
Sequence:CCGGGCAGTTTAACTTGGGCAATAGCTCGAGCTATTGCCCAAGTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-356s21c1
Sequence:CCGGATCAGTGCCGCAACTCCATTCCTCGAGGAATGGAGTTGCGGCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024738.1-1199s1c1
Sequence:CCGGGCCATTCTAGTTGAATATGTTCTCGAGAACATATTCAACTAGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024738.1-703s1c1
Sequence:CCGGCCCATAGCAAAGTATTGCTATCTCGAGATAGCAATACTTTGCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024738.1-446s1c1
Sequence:CCGGGCTGTAATGTCAACGTCCCTACTCGAGTAGGGACGTTGACATTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024738.1-420s1c1
Sequence:CCGGGAGGAAGGATTTGCTGGTAAACTCGAGTTTACCAGCAAATCCTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024738.1-319s1c1
Sequence:CCGGGTGCAGTTTAACTTGGGCAATCTCGAGATTGCCCAAGTTAAACTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024738
VALIDATED
C12orf49 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 49
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-396s21c1
Sequence:CCGGGGATGAACTCGGCTACGTTTGCTCGAGCAAACGTAGCCGAGTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-635s21c1
Sequence:CCGGTTGAGTTGTGCCTGGCCAAATCTCGAGATTTGGCCAGGCACAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-433s21c1
Sequence:CCGGCTGGTAAATGGCTGCTGTAATCTCGAGATTACAGCAGCCATTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-281s21c1
Sequence:CCGGTCCAGGTTCATGACCATAATCCTCGAGGATTATGGTCATGAACCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-321s21c1
Sequence:CCGGGCAGTTTAACTTGGGCAATAGCTCGAGCTATTGCCCAAGTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024738.1-356s21c1
Sequence:CCGGATCAGTGCCGCAACTCCATTCCTCGAGGAATGGAGTTGCGGCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024738.1-1199s1c1
Sequence:CCGGGCCATTCTAGTTGAATATGTTCTCGAGAACATATTCAACTAGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024738.1-703s1c1
Sequence:CCGGCCCATAGCAAAGTATTGCTATCTCGAGATAGCAATACTTTGCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024738.1-446s1c1
Sequence:CCGGGCTGTAATGTCAACGTCCCTACTCGAGTAGGGACGTTGACATTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024738.1-420s1c1
Sequence:CCGGGAGGAAGGATTTGCTGGTAAACTCGAGTTTACCAGCAAATCCTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024738.1-319s1c1
Sequence:CCGGGTGCAGTTTAACTTGGGCAATCTCGAGATTGCCCAAGTTAAACTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks