EMAIL THIS PAGE TO A FRIEND

C12orf4

chromosome 12 open reading frame 4

20 Gene Product Result for
Species: Human C12orf4(57102)
UniProtKB ID: Q9NQ89, D3DUQ8, Q6MZH5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020374 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038591 MISSION® esiRNA esiRNA human AC008012.8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020374 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186587 predicted 1706
2 SASI_Hs01_00186588 predicted 514
3 SASI_Hs01_00186589 predicted 1173
4 SASI_Hs01_00186590 predicted 634
5 SASI_Hs01_00186591 predicted 938
6 SASI_Hs01_00186592 predicted 1449
7 SASI_Hs01_00186593 predicted 750
8 SASI_Hs01_00186594 predicted 1434
9 SASI_Hs02_00353333 predicted 1569
10 SASI_Hs01_00186595 predicted 386
11 SASI_Hs01_00186596 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020374
C12orf4 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020374.2-1810s1c1
Sequence:CCGGGCTGGGAATCTGTCAAGCAAACTCGAGTTTGCTTGACAGATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-749s1c1
Sequence:CCGGCAAGAGTATCAAGAATGGGTACTCGAGTACCCATTCTTGATACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-313s1c1
Sequence:CCGGCGATTATGATAGAGATGCTGACTCGAGTCAGCATCTCTATCATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020374.2-1473s1c1
Sequence:CCGGCCCATGACATCACAACAATAACTCGAGTTATTGTTGTGATGTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020374.2-2479s1c1
Sequence:CCGGGCTCATCAACATTGTGACAATCTCGAGATTGTCACAATGTTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020374.2-179s1c1
Sequence:CCGGCCACTCAAATTTCCTGTTCAACTCGAGTTGAACAGGAAATTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-973s1c1
Sequence:CCGGGCTGGACTTCTGTAAGCATAACTCGAGTTATGCTTACAGAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020374.2-1223s1c1
Sequence:CCGGCGCAGGAGTAAATTGAAAGAACTCGAGTTCTTTCAATTTACTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-347s1c1
Sequence:CCGGGCTGTGAAATCAGGTGAAGTACTCGAGTACTTCACCTGATTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020374
C12orf4 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020374.2-1810s1c1
Sequence:CCGGGCTGGGAATCTGTCAAGCAAACTCGAGTTTGCTTGACAGATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-749s1c1
Sequence:CCGGCAAGAGTATCAAGAATGGGTACTCGAGTACCCATTCTTGATACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-313s1c1
Sequence:CCGGCGATTATGATAGAGATGCTGACTCGAGTCAGCATCTCTATCATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020374.2-1473s1c1
Sequence:CCGGCCCATGACATCACAACAATAACTCGAGTTATTGTTGTGATGTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020374.2-2479s1c1
Sequence:CCGGGCTCATCAACATTGTGACAATCTCGAGATTGTCACAATGTTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020374.2-179s1c1
Sequence:CCGGCCACTCAAATTTCCTGTTCAACTCGAGTTGAACAGGAAATTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-973s1c1
Sequence:CCGGGCTGGACTTCTGTAAGCATAACTCGAGTTATGCTTACAGAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020374.2-1223s1c1
Sequence:CCGGCGCAGGAGTAAATTGAAAGAACTCGAGTTCTTTCAATTTACTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-347s1c1
Sequence:CCGGGCTGTGAAATCAGGTGAAGTACTCGAGTACTTCACCTGATTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020374
C12orf4 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020374.2-1810s1c1
Sequence:CCGGGCTGGGAATCTGTCAAGCAAACTCGAGTTTGCTTGACAGATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-749s1c1
Sequence:CCGGCAAGAGTATCAAGAATGGGTACTCGAGTACCCATTCTTGATACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-313s1c1
Sequence:CCGGCGATTATGATAGAGATGCTGACTCGAGTCAGCATCTCTATCATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020374.2-1473s1c1
Sequence:CCGGCCCATGACATCACAACAATAACTCGAGTTATTGTTGTGATGTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020374.2-2479s1c1
Sequence:CCGGGCTCATCAACATTGTGACAATCTCGAGATTGTCACAATGTTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020374.2-179s1c1
Sequence:CCGGCCACTCAAATTTCCTGTTCAACTCGAGTTGAACAGGAAATTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-973s1c1
Sequence:CCGGGCTGGACTTCTGTAAGCATAACTCGAGTTATGCTTACAGAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020374.2-1223s1c1
Sequence:CCGGCGCAGGAGTAAATTGAAAGAACTCGAGTTCTTTCAATTTACTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020374.2-347s1c1
Sequence:CCGGGCTGTGAAATCAGGTGAAGTACTCGAGTACTTCACCTGATTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks