EMAIL THIS PAGE TO A FRIEND

C12orf50

chromosome 12 open reading frame 50

98 Gene Product Result for
UniProtKB ID: Q8NA57, Q6P674
Gene ID:
chicken(417885) chromosome 1 open reading frame, human C12orf50
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103554 Anti-C12orf50 (121-135) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2103987 Anti-C12ORF50, (N-terminal) antibody produced in rabbit affinity isolated antibody human, bovine, rat, guinea pig, rabbit, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152589 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144081 MISSION® esiRNA esiRNA human C12orf50 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152589 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010267 predicted 1297
2 SASI_Hs01_00010268 predicted 536
3 SASI_Hs01_00010269 predicted 923
4 SASI_Hs01_00010270 predicted 1255
5 SASI_Hs01_00010271 predicted 636
6 SASI_Hs01_00010272 predicted 994
7 SASI_Hs01_00010273 predicted 225
8 SASI_Hs01_00010274 predicted 788
9 SASI_Hs01_00010275 predicted 1403
10 SASI_Hs02_00366428 predicted 1060
11 SASI_Hs01_00010276 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152589
C12orf50 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 50
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-1120s21c1
Sequence:CCGGATGAGTTATCACCGCAATAATCTCGAGATTATTGCGGTGATAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152589.1-1449s21c1
Sequence:CCGGTTGCCAGACATCATCTGATTTCTCGAGAAATCAGATGATGTCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-285s21c1
Sequence:CCGGTTTGCCACCAAGTAGCAATATCTCGAGATATTGCTACTTGGTGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-1152s21c1
Sequence:CCGGTGCGGAGAATGCATCCTATATCTCGAGATATAGGATGCATTCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-1232s21c1
Sequence:CCGGCCACGCATGGGTCCTACAATACTCGAGTATTGTAGGACCCATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152589.1-1511s1c1
Sequence:CCGGCTCCATGTTATGTAGTGGATACTCGAGTATCCACTACATAACATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152589.1-262s1c1
Sequence:CCGGCCTCGAAATATCAATGGATTACTCGAGTAATCCATTGATATTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152589
C12orf50 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 50
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-1120s21c1
Sequence:CCGGATGAGTTATCACCGCAATAATCTCGAGATTATTGCGGTGATAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152589.1-1449s21c1
Sequence:CCGGTTGCCAGACATCATCTGATTTCTCGAGAAATCAGATGATGTCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-285s21c1
Sequence:CCGGTTTGCCACCAAGTAGCAATATCTCGAGATATTGCTACTTGGTGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-1152s21c1
Sequence:CCGGTGCGGAGAATGCATCCTATATCTCGAGATATAGGATGCATTCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-1232s21c1
Sequence:CCGGCCACGCATGGGTCCTACAATACTCGAGTATTGTAGGACCCATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152589.1-1511s1c1
Sequence:CCGGCTCCATGTTATGTAGTGGATACTCGAGTATCCACTACATAACATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152589.1-262s1c1
Sequence:CCGGCCTCGAAATATCAATGGATTACTCGAGTAATCCATTGATATTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152589
C12orf50 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 50
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-1120s21c1
Sequence:CCGGATGAGTTATCACCGCAATAATCTCGAGATTATTGCGGTGATAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152589.1-1449s21c1
Sequence:CCGGTTGCCAGACATCATCTGATTTCTCGAGAAATCAGATGATGTCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-285s21c1
Sequence:CCGGTTTGCCACCAAGTAGCAATATCTCGAGATATTGCTACTTGGTGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-1152s21c1
Sequence:CCGGTGCGGAGAATGCATCCTATATCTCGAGATATAGGATGCATTCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152589.1-1232s21c1
Sequence:CCGGCCACGCATGGGTCCTACAATACTCGAGTATTGTAGGACCCATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152589.1-1511s1c1
Sequence:CCGGCTCCATGTTATGTAGTGGATACTCGAGTATCCACTACATAACATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152589.1-262s1c1
Sequence:CCGGCCTCGAAATATCAATGGATTACTCGAGTAATCCATTGATATTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks