EMAIL THIS PAGE TO A FRIEND

C12orf52

chromosome 12 open reading frame 52

28 Gene Product Result for
Synonyms: RITA
Species: Human C12orf52(84934)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032848 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146541 MISSION® esiRNA esiRNA human C12orf52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032848 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062745 predicted 1206
2 SASI_Hs01_00062746 predicted 1443
3 SASI_Hs01_00062747 predicted 1279
4 SASI_Hs01_00062749 predicted 1187
5 SASI_Hs01_00062750 predicted 867
6 SASI_Hs01_00062751 predicted 1258
7 SASI_Hs01_00062752 predicted 635
8 SASI_Hs01_00062753 predicted 1004
9 SASI_Hs01_00062754 predicted 1063
10 SASI_Hs02_00360444 predicted 807
11 SASI_Hs01_00062748 predicted 1335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032848
VALIDATED
C12orf52 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 52
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032848.1-741s1c1
Sequence:CCGGCCTCACACCAAGGAAGAAGAACTCGAGTTCTTCTTCCTTGGTGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032848.1-1011s1c1
Sequence:CCGGGAAGTTATCTATGGGTGGGTTCTCGAGAACCCACCCATAGATAACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032848.1-1065s1c1
Sequence:CCGGCCATTCCCTCACCCACCTGAACTCGAGTTCAGGTGGGTGAGGGAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032848.1-1513s1c1
Sequence:CCGGCCTGTCTCAACCATACTCCAACTCGAGTTGGAGTATGGTTGAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032848.1-1205s1c1
Sequence:CCGGCAGTTAGCATTTCAGTGCCATCTCGAGATGGCACTGAAATGCTAACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032848.1-1513s21c1
Sequence:CCGGCCTGTCTCAACCATACTCCAACTCGAGTTGGAGTATGGTTGAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032848.1-1065s21c1
Sequence:CCGGCCATTCCCTCACCCACCTGAACTCGAGTTCAGGTGGGTGAGGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032848.1-741s21c1
Sequence:CCGGCCTCACACCAAGGAAGAAGAACTCGAGTTCTTCTTCCTTGGTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032848.1-1205s21c1
Sequence:CCGGCAGTTAGCATTTCAGTGCCATCTCGAGATGGCACTGAAATGCTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032848
VALIDATED
C12orf52 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 52
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032848.1-741s1c1
Sequence:CCGGCCTCACACCAAGGAAGAAGAACTCGAGTTCTTCTTCCTTGGTGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032848.1-1011s1c1
Sequence:CCGGGAAGTTATCTATGGGTGGGTTCTCGAGAACCCACCCATAGATAACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032848.1-1065s1c1
Sequence:CCGGCCATTCCCTCACCCACCTGAACTCGAGTTCAGGTGGGTGAGGGAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032848.1-1513s1c1
Sequence:CCGGCCTGTCTCAACCATACTCCAACTCGAGTTGGAGTATGGTTGAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032848.1-1205s1c1
Sequence:CCGGCAGTTAGCATTTCAGTGCCATCTCGAGATGGCACTGAAATGCTAACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032848.1-1513s21c1
Sequence:CCGGCCTGTCTCAACCATACTCCAACTCGAGTTGGAGTATGGTTGAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032848.1-1065s21c1
Sequence:CCGGCCATTCCCTCACCCACCTGAACTCGAGTTCAGGTGGGTGAGGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032848.1-741s21c1
Sequence:CCGGCCTCACACCAAGGAAGAAGAACTCGAGTTCTTCTTCCTTGGTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032848.1-1205s21c1
Sequence:CCGGCAGTTAGCATTTCAGTGCCATCTCGAGATGGCACTGAAATGCTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032848
VALIDATED
C12orf52 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 52
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032848.1-741s1c1
Sequence:CCGGCCTCACACCAAGGAAGAAGAACTCGAGTTCTTCTTCCTTGGTGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032848.1-1011s1c1
Sequence:CCGGGAAGTTATCTATGGGTGGGTTCTCGAGAACCCACCCATAGATAACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032848.1-1065s1c1
Sequence:CCGGCCATTCCCTCACCCACCTGAACTCGAGTTCAGGTGGGTGAGGGAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032848.1-1513s1c1
Sequence:CCGGCCTGTCTCAACCATACTCCAACTCGAGTTGGAGTATGGTTGAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032848.1-1205s1c1
Sequence:CCGGCAGTTAGCATTTCAGTGCCATCTCGAGATGGCACTGAAATGCTAACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032848.1-1513s21c1
Sequence:CCGGCCTGTCTCAACCATACTCCAACTCGAGTTGGAGTATGGTTGAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032848.1-1065s21c1
Sequence:CCGGCCATTCCCTCACCCACCTGAACTCGAGTTCAGGTGGGTGAGGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032848.1-741s21c1
Sequence:CCGGCCTCACACCAAGGAAGAAGAACTCGAGTTCTTCTTCCTTGGTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032848.1-1205s21c1
Sequence:CCGGCAGTTAGCATTTCAGTGCCATCTCGAGATGGCACTGAAATGCTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)