EMAIL THIS PAGE TO A FRIEND

C12orf54

chromosome 12 open reading frame 54

20 Gene Product Result for
Synonyms: HSD-29 HSD-30
Species: Human C12orf54(121273)
UniProtKB ID: Q6X4T0, Q6X4S9, Q8N5S2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152319 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138351 MISSION® esiRNA esiRNA human C12orf54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152319 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080837 predicted 433
2 SASI_Hs01_00080838 predicted 233
3 SASI_Hs01_00080839 predicted 432
4 SASI_Hs01_00080840 predicted 371
5 SASI_Hs01_00080841 predicted 392
6 SASI_Hs01_00080842 predicted 412
7 SASI_Hs01_00080843 predicted 241
8 SASI_Hs01_00080844 predicted 225
9 SASI_Hs01_00080845 predicted 265
10 SASI_Hs02_00365907 predicted 258
11 SASI_Hs01_00080846 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152319
C12orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 54
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-390s1c1
Sequence:CCGGCAACCTGAAGACACAGCTCTTCTCGAGAAGAGCTGTGTCTTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-114s1c1
Sequence:CCGGGCAGAGAAGCACATCCATAGACTCGAGTCTATGGATGTGCTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-299s1c1
Sequence:CCGGGAAGCATAAGGCCTCCAGATTCTCGAGAATCTGGAGGCCTTATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-112s1c1
Sequence:CCGGCAGCAGAGAAGCACATCCATACTCGAGTATGGATGTGCTTCTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152319.2-498s1c1
Sequence:CCGGGAAGATATTAGCAGACATCATCTCGAGATGATGTCTGCTAATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-125s1c1
Sequence:CCGGCATCCATAGAAGAGACAATGACTCGAGTCATTGTCTCTTCTATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-122s1c1
Sequence:CCGGGCACATCCATAGAAGAGACAACTCGAGTTGTCTCTTCTATGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-136s1c1
Sequence:CCGGGAGACAATGAGACCACAGGAACTCGAGTTCCTGTGGTCTCATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-303s1c1
Sequence:CCGGCATAAGGCCTCCAGATTCCTTCTCGAGAAGGAATCTGGAGGCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152319
C12orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 54
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-390s1c1
Sequence:CCGGCAACCTGAAGACACAGCTCTTCTCGAGAAGAGCTGTGTCTTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-114s1c1
Sequence:CCGGGCAGAGAAGCACATCCATAGACTCGAGTCTATGGATGTGCTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-299s1c1
Sequence:CCGGGAAGCATAAGGCCTCCAGATTCTCGAGAATCTGGAGGCCTTATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-112s1c1
Sequence:CCGGCAGCAGAGAAGCACATCCATACTCGAGTATGGATGTGCTTCTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152319.2-498s1c1
Sequence:CCGGGAAGATATTAGCAGACATCATCTCGAGATGATGTCTGCTAATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-125s1c1
Sequence:CCGGCATCCATAGAAGAGACAATGACTCGAGTCATTGTCTCTTCTATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-122s1c1
Sequence:CCGGGCACATCCATAGAAGAGACAACTCGAGTTGTCTCTTCTATGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-136s1c1
Sequence:CCGGGAGACAATGAGACCACAGGAACTCGAGTTCCTGTGGTCTCATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-303s1c1
Sequence:CCGGCATAAGGCCTCCAGATTCCTTCTCGAGAAGGAATCTGGAGGCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152319
C12orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 54
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-390s1c1
Sequence:CCGGCAACCTGAAGACACAGCTCTTCTCGAGAAGAGCTGTGTCTTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-114s1c1
Sequence:CCGGGCAGAGAAGCACATCCATAGACTCGAGTCTATGGATGTGCTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-299s1c1
Sequence:CCGGGAAGCATAAGGCCTCCAGATTCTCGAGAATCTGGAGGCCTTATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-112s1c1
Sequence:CCGGCAGCAGAGAAGCACATCCATACTCGAGTATGGATGTGCTTCTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152319.2-498s1c1
Sequence:CCGGGAAGATATTAGCAGACATCATCTCGAGATGATGTCTGCTAATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-125s1c1
Sequence:CCGGCATCCATAGAAGAGACAATGACTCGAGTCATTGTCTCTTCTATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-122s1c1
Sequence:CCGGGCACATCCATAGAAGAGACAACTCGAGTTGTCTCTTCTATGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-136s1c1
Sequence:CCGGGAGACAATGAGACCACAGGAACTCGAGTTCCTGTGGTCTCATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152319.2-303s1c1
Sequence:CCGGCATAAGGCCTCCAGATTCCTTCTCGAGAAGGAATCTGGAGGCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks