EMAIL THIS PAGE TO A FRIEND

C12orf56

chromosome 12 open reading frame 56

26 Gene Product Result for
Species: Human C12orf56(115749)
UniProtKB ID: Q8IXR9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099676 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039461 MISSION® esiRNA esiRNA human C12orf56 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099676 Rosetta Predictions human pricing
XM_056680 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321008 predicted 346
2 SASI_Hs02_00321009 predicted 294
3 SASI_Hs02_00321010 predicted 246
4 SASI_Hs02_00321011 predicted 503
5 SASI_Hs02_00321012 predicted 1112
6 SASI_Hs02_00321013 predicted 916
7 SASI_Hs02_00321014 predicted 788
8 SASI_Hs02_00321015 predicted 813
9 SASI_Hs02_00321016 predicted 1020
10 SASI_Hs02_00321017 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_056680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274289 predicted 353
2 SASI_Hs01_00274290 predicted 301
3 SASI_Hs01_00274291 predicted 251
4 SASI_Hs01_00274292 predicted 1119
5 SASI_Hs01_00274293 predicted 926
6 SASI_Hs01_00274294 predicted 799
7 SASI_Hs01_00274295 predicted 819
8 SASI_Hs01_00274296 predicted 1025
9 SASI_Hs01_00274297 predicted 1268
10 SASI_Hs01_00274298 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099676
C12orf56 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 56
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-504s21c1
Sequence:CCGGTAAGCACTTCAGTCAACTTAACTCGAGTTAAGTTGACTGAAGTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-253s21c1
Sequence:CCGGATTGATGATTACCCGGAATTTCTCGAGAAATTCCGGGTAATCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-824s21c1
Sequence:CCGGCTAAGAAGGGAGCACTATTTACTCGAGTAAATAGTGCTCCCTTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099676.2-1404s21c1
Sequence:CCGGCGCAATGTTAATAAGAGTATACTCGAGTATACTCTTATTAACATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-1237s21c1
Sequence:CCGGAGGACTCTAGCTGAGTATATTCTCGAGAATATACTCAGCTAGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099676
C12orf56 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 56
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-504s21c1
Sequence:CCGGTAAGCACTTCAGTCAACTTAACTCGAGTTAAGTTGACTGAAGTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-253s21c1
Sequence:CCGGATTGATGATTACCCGGAATTTCTCGAGAAATTCCGGGTAATCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-824s21c1
Sequence:CCGGCTAAGAAGGGAGCACTATTTACTCGAGTAAATAGTGCTCCCTTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099676.2-1404s21c1
Sequence:CCGGCGCAATGTTAATAAGAGTATACTCGAGTATACTCTTATTAACATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-1237s21c1
Sequence:CCGGAGGACTCTAGCTGAGTATATTCTCGAGAATATACTCAGCTAGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099676
C12orf56 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 56
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-504s21c1
Sequence:CCGGTAAGCACTTCAGTCAACTTAACTCGAGTTAAGTTGACTGAAGTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-253s21c1
Sequence:CCGGATTGATGATTACCCGGAATTTCTCGAGAAATTCCGGGTAATCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-824s21c1
Sequence:CCGGCTAAGAAGGGAGCACTATTTACTCGAGTAAATAGTGCTCCCTTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099676.2-1404s21c1
Sequence:CCGGCGCAATGTTAATAAGAGTATACTCGAGTATACTCTTATTAACATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099676.2-1237s21c1
Sequence:CCGGAGGACTCTAGCTGAGTATATTCTCGAGAATATACTCAGCTAGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks