EMAIL THIS PAGE TO A FRIEND

C12orf57

chromosome 12 open reading frame 57

30 Gene Product Result for
Synonyms: C10 GRCC10 TEMTYS
UniProtKB ID: Q99622, B2R4Q6
Gene ID:
chicken(771099) chromosome 1 open reading frame, human C12orf57
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138425 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035651 MISSION® esiRNA esiRNA human C12orf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138425 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219288 predicted 261
2 SASI_Hs01_00219289 predicted 209
3 SASI_Hs01_00219290 predicted 199
4 SASI_Hs01_00219291 predicted 221
5 SASI_Hs01_00219292 predicted 195
6 SASI_Hs01_00219293 predicted 311
7 SASI_Hs01_00219294 predicted 274
8 SASI_Hs01_00219295 predicted 209
9 SASI_Hs01_00219296 predicted 257
10 SASI_Hs01_00219297 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138425
VALIDATED
C12orf57 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 57
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138425.2-221s21c1
Sequence:CCGGATGGGTAAGATGCTGCAATTCCTCGAGGAATTGCAGCATCTTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138425.2-330s21c1
Sequence:CCGGGCTTGGTCAAGTCCTACGAAGCTCGAGCTTCGTAGGACTTGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138425.2-306s21c1
Sequence:CCGGGGGAAGGTGTCCTTAAGTTTGCTCGAGCAAACTTAAGGACACCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138425.2-264s21c1
Sequence:CCGGTCCAGCAGGAGGTTATCAAAGCTCGAGCTTTGATAACCTCCTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138425.2-262s1c1
Sequence:CCGGGATCCAGCAGGAGGTTATCAACTCGAGTTGATAACCTCCTGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138425.2-269s1c1
Sequence:CCGGCAGGAGGTTATCAAAGCCTATCTCGAGATAGGCTTTGATAACCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138425
VALIDATED
C12orf57 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 57
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138425.2-221s21c1
Sequence:CCGGATGGGTAAGATGCTGCAATTCCTCGAGGAATTGCAGCATCTTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138425.2-330s21c1
Sequence:CCGGGCTTGGTCAAGTCCTACGAAGCTCGAGCTTCGTAGGACTTGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138425.2-306s21c1
Sequence:CCGGGGGAAGGTGTCCTTAAGTTTGCTCGAGCAAACTTAAGGACACCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138425.2-264s21c1
Sequence:CCGGTCCAGCAGGAGGTTATCAAAGCTCGAGCTTTGATAACCTCCTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138425.2-262s1c1
Sequence:CCGGGATCCAGCAGGAGGTTATCAACTCGAGTTGATAACCTCCTGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138425.2-269s1c1
Sequence:CCGGCAGGAGGTTATCAAAGCCTATCTCGAGATAGGCTTTGATAACCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138425
VALIDATED
C12orf57 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 57
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138425.2-221s21c1
Sequence:CCGGATGGGTAAGATGCTGCAATTCCTCGAGGAATTGCAGCATCTTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138425.2-330s21c1
Sequence:CCGGGCTTGGTCAAGTCCTACGAAGCTCGAGCTTCGTAGGACTTGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138425.2-306s21c1
Sequence:CCGGGGGAAGGTGTCCTTAAGTTTGCTCGAGCAAACTTAAGGACACCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138425.2-264s21c1
Sequence:CCGGTCCAGCAGGAGGTTATCAAAGCTCGAGCTTTGATAACCTCCTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138425.2-262s1c1
Sequence:CCGGGATCCAGCAGGAGGTTATCAACTCGAGTTGATAACCTCCTGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138425.2-269s1c1
Sequence:CCGGCAGGAGGTTATCAAAGCCTATCTCGAGATAGGCTTTGATAACCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks