EMAIL THIS PAGE TO A FRIEND

C12orf5

chromosome 12 open reading frame 5

34 Gene Product Result for
Synonyms: FR2BP TIGAR
Species: Human C12orf5(57103)
Gene ID:
Human(57103) Summary: This gene is regulated as part of the p53 tumor suppressor pathway and encodes a protein with sequence similarity to the bisphosphate domain of the glycolytic enzyme that degrades fructose-2,6-bisphosphate. The protein functions by blocking glycolysis and directing the pathway into the pentose phosphate shunt. Expression of this protein also protects cells from DNA damaging reactive oxygen species and provides some protection from DNA damage-induced apoptosis. The 12p13.32 region that includes this gene is paralogous to the 11q13.3 region. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C1621 Anti-C12orf5 (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C1746 Anti-C12orf5 (146-158) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2900356 Anti-C12orf5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunohistochemistry, western blot pricing
SAB2900266 Anti-C12orf5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
PRS4049 Anti-TIGAR (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
PRS4051 Anti-TIGAR (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA040354 Anti-TIGAR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA044111 Anti-TIGAR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1305902 ANTI-TIGAR(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
T8828 Monoclonal Anti-TIGAR antibody produced in mouse ~1.0 mg/mL, clone 9C10, purified immunoglobulin, buffered aqueous solution human, monkey
ELISA, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020375 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006891 MISSION® esiRNA esiRNA targeting human C12orf5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020375 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070173 predicted 869
2 SASI_Hs01_00070174 predicted 841
3 SASI_Hs01_00070175 predicted 647
4 SASI_Hs01_00070177 predicted 505
5 SASI_Hs01_00070178 predicted 856
6 SASI_Hs01_00070179 predicted 316
7 SASI_Hs01_00070180 predicted 770
8 SASI_Hs01_00070181 predicted 245
9 SASI_Hs01_00070182 predicted 303
10 SASI_Hs02_00353334 predicted 324
11 SASI_Hs01_00070176 predicted 734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020375
VALIDATED
C12orf5 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-97s1c1
Sequence:CCGGGCATGGAGAAACAAGATTTAACTCGAGTTAAATCTTGTTTCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-188s1c1
Sequence:CCGGGCTGCTGGTATATTTCTGAATCTCGAGATTCAGAAATATACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020375.1-824s1c1
Sequence:CCGGCAGTGTATTTGTATGAACCTACTCGAGTAGGTTCATACAAATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-665s1c1
Sequence:CCGGGCTTACATGAGAAGTCTGTTTCTCGAGAAACAGACTTCTCATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-614s1c1
Sequence:CCGGGACAGCGGTATTCCAGGATTACTCGAGTAATCCTGGAATACCGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020375.2-880s21c1
Sequence:CCGGTGAAACTCGCTAAGGTTAAATCTCGAGATTTAACCTTAGCGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020375.2-1037s21c1
Sequence:CCGGCTTTAATGGACAACCATATAGCTCGAGCTATATGGTTGTCCATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020375.2-1223s21c1
Sequence:CCGGTAATGGCTATTGGTAAGATACCTCGAGGTATCTTACCAATAGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020375
VALIDATED
C12orf5 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-97s1c1
Sequence:CCGGGCATGGAGAAACAAGATTTAACTCGAGTTAAATCTTGTTTCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-188s1c1
Sequence:CCGGGCTGCTGGTATATTTCTGAATCTCGAGATTCAGAAATATACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020375.1-824s1c1
Sequence:CCGGCAGTGTATTTGTATGAACCTACTCGAGTAGGTTCATACAAATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-665s1c1
Sequence:CCGGGCTTACATGAGAAGTCTGTTTCTCGAGAAACAGACTTCTCATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-614s1c1
Sequence:CCGGGACAGCGGTATTCCAGGATTACTCGAGTAATCCTGGAATACCGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020375.2-880s21c1
Sequence:CCGGTGAAACTCGCTAAGGTTAAATCTCGAGATTTAACCTTAGCGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020375.2-1037s21c1
Sequence:CCGGCTTTAATGGACAACCATATAGCTCGAGCTATATGGTTGTCCATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020375.2-1223s21c1
Sequence:CCGGTAATGGCTATTGGTAAGATACCTCGAGGTATCTTACCAATAGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020375
VALIDATED
C12orf5 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-97s1c1
Sequence:CCGGGCATGGAGAAACAAGATTTAACTCGAGTTAAATCTTGTTTCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-188s1c1
Sequence:CCGGGCTGCTGGTATATTTCTGAATCTCGAGATTCAGAAATATACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020375.1-824s1c1
Sequence:CCGGCAGTGTATTTGTATGAACCTACTCGAGTAGGTTCATACAAATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-665s1c1
Sequence:CCGGGCTTACATGAGAAGTCTGTTTCTCGAGAAACAGACTTCTCATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020375.1-614s1c1
Sequence:CCGGGACAGCGGTATTCCAGGATTACTCGAGTAATCCTGGAATACCGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020375.2-880s21c1
Sequence:CCGGTGAAACTCGCTAAGGTTAAATCTCGAGATTTAACCTTAGCGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020375.2-1037s21c1
Sequence:CCGGCTTTAATGGACAACCATATAGCTCGAGCTATATGGTTGTCCATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020375.2-1223s21c1
Sequence:CCGGTAATGGCTATTGGTAAGATACCTCGAGGTATCTTACCAATAGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks