EMAIL THIS PAGE TO A FRIEND

C12orf60

chromosome 12 open reading frame 60

36 Gene Product Result for
Species: Human C12orf60(144608)
UniProtKB ID: Q5U649, A8K1M7, Q5XKK8, Q8IXY2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175874 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042071 MISSION® esiRNA esiRNA human C12orf60 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175874 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045379 predicted 558
2 SASI_Hs02_00369150 predicted 524
3 SASI_Hs02_00369151 predicted 268
4 SASI_Hs01_00045380 predicted 677
5 SASI_Hs01_00045382 predicted 691
6 SASI_Hs01_00045383 predicted 313
7 SASI_Hs01_00045386 predicted 742
8 SASI_Hs01_00045387 predicted 649
9 SASI_Hs02_00369152 predicted 228
10 SASI_Hs01_00045388 predicted 353
11 SASI_Hs01_00045381 predicted 258
12 SASI_Hs01_00045384 predicted 815
13 SASI_Hs01_00045385 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175874
C12orf60 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 60
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-918s1c1
Sequence:CCGGGTTTAAGAAAGCCAGTGACAACTCGAGTTGTCACTGGCTTTCTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-289s1c1
Sequence:CCGGGTCATAAACACACTGACTGAACTCGAGTTCAGTCAGTGTGTTTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-863s1c1
Sequence:CCGGCAATCTTAGAGATCCTCCAAACTCGAGTTTGGAGGATCTCTAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-318s1c1
Sequence:CCGGCCGCAGTATGAATACTCAAATCTCGAGATTTGAGTATTCATACTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-686s1c1
Sequence:CCGGCCAAAGAGCAATCAGATGTCACTCGAGTGACATCTGATTGCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-812s1c1
Sequence:CCGGCCACAAAGTCAGCAGCAGATTCTCGAGAATCTGCTGCTGACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-520s1c1
Sequence:CCGGGAGTTGCATCAGTCAGCTAAACTCGAGTTTAGCTGACTGATGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-862s1c1
Sequence:CCGGCCAATCTTAGAGATCCTCCAACTCGAGTTGGAGGATCTCTAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-643s1c1
Sequence:CCGGCCCATCATGAATCTTCAATTACTCGAGTAATTGAAGATTCATGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175874.2-944s1c1
Sequence:CCGGGATGCAACAGAAATGTTCATTCTCGAGAATGAACATTTCTGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122246    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175874.2-947s1c1
Sequence:CCGGGCAACAGAAATGTTCATTTCTCTCGAGAGAAATGAACATTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175874
C12orf60 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 60
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-918s1c1
Sequence:CCGGGTTTAAGAAAGCCAGTGACAACTCGAGTTGTCACTGGCTTTCTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-289s1c1
Sequence:CCGGGTCATAAACACACTGACTGAACTCGAGTTCAGTCAGTGTGTTTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-863s1c1
Sequence:CCGGCAATCTTAGAGATCCTCCAAACTCGAGTTTGGAGGATCTCTAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-318s1c1
Sequence:CCGGCCGCAGTATGAATACTCAAATCTCGAGATTTGAGTATTCATACTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-686s1c1
Sequence:CCGGCCAAAGAGCAATCAGATGTCACTCGAGTGACATCTGATTGCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-812s1c1
Sequence:CCGGCCACAAAGTCAGCAGCAGATTCTCGAGAATCTGCTGCTGACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-520s1c1
Sequence:CCGGGAGTTGCATCAGTCAGCTAAACTCGAGTTTAGCTGACTGATGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-862s1c1
Sequence:CCGGCCAATCTTAGAGATCCTCCAACTCGAGTTGGAGGATCTCTAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-643s1c1
Sequence:CCGGCCCATCATGAATCTTCAATTACTCGAGTAATTGAAGATTCATGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175874.2-944s1c1
Sequence:CCGGGATGCAACAGAAATGTTCATTCTCGAGAATGAACATTTCTGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122246    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175874.2-947s1c1
Sequence:CCGGGCAACAGAAATGTTCATTTCTCTCGAGAGAAATGAACATTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175874
C12orf60 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 60
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-918s1c1
Sequence:CCGGGTTTAAGAAAGCCAGTGACAACTCGAGTTGTCACTGGCTTTCTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-289s1c1
Sequence:CCGGGTCATAAACACACTGACTGAACTCGAGTTCAGTCAGTGTGTTTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-863s1c1
Sequence:CCGGCAATCTTAGAGATCCTCCAAACTCGAGTTTGGAGGATCTCTAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-318s1c1
Sequence:CCGGCCGCAGTATGAATACTCAAATCTCGAGATTTGAGTATTCATACTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-686s1c1
Sequence:CCGGCCAAAGAGCAATCAGATGTCACTCGAGTGACATCTGATTGCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175874.2-812s1c1
Sequence:CCGGCCACAAAGTCAGCAGCAGATTCTCGAGAATCTGCTGCTGACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-520s1c1
Sequence:CCGGGAGTTGCATCAGTCAGCTAAACTCGAGTTTAGCTGACTGATGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-862s1c1
Sequence:CCGGCCAATCTTAGAGATCCTCCAACTCGAGTTGGAGGATCTCTAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175874.2-643s1c1
Sequence:CCGGCCCATCATGAATCTTCAATTACTCGAGTAATTGAAGATTCATGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175874.2-944s1c1
Sequence:CCGGGATGCAACAGAAATGTTCATTCTCGAGAATGAACATTTCTGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122246    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175874.2-947s1c1
Sequence:CCGGGCAACAGAAATGTTCATTTCTCTCGAGAGAAATGAACATTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks