EMAIL THIS PAGE TO A FRIEND

C12orf61

chromosome 12 open reading frame 61

15 Gene Product Result for
Species: Human C12orf61(283416)
UniProtKB ID: Q8N7H1, B2RMN9, Q3ZCV4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301010 ANTI-C12ORF61 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175895 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175895 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234255 predicted 873
2 SASI_Hs01_00234256 predicted 876
3 SASI_Hs01_00234257 predicted 881
4 SASI_Hs01_00234258 predicted 882
5 SASI_Hs01_00234259 predicted 911
6 SASI_Hs01_00234260 predicted 905
7 SASI_Hs01_00234261 predicted 314
8 SASI_Hs01_00234262 predicted 314
9 SASI_Hs01_00234263 predicted 333
10 SASI_Hs01_00234264 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175895
C12orf61 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 61
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-737s1c1
Sequence:CCGGCTACCAGAAATCAGCCCTGAACTCGAGTTCAGGGCTGATTTCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1370s1c1
Sequence:CCGGGACTGTATCTGGCAACCCTATCTCGAGATAGGGTTGCCAGATACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1475s1c1
Sequence:CCGGGAATTGTCTTTGCCCAGACTTCTCGAGAAGTCTGGGCAAAGACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-596s1c1
Sequence:CCGGCGAACCTTAGAGATCACTTAACTCGAGTTAAGTGATCTCTAAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1270s1c1
Sequence:CCGGGAATTTCAGATAACCAGTGTTCTCGAGAACACTGGTTATCTGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1464s1c1
Sequence:CCGGCCTACAACTTAGAATTGTCTTCTCGAGAAGACAATTCTAAGTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163046    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-594s1c1
Sequence:CCGGGACGAACCTTAGAGATCACTTCTCGAGAAGTGATCTCTAAGGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1486s1c1
Sequence:CCGGGCCCAGACTTTGATCCTTCATCTCGAGATGAAGGATCAAAGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175895.3-726s21c1
Sequence:CCGGCGTCAGCGTGCTACCAGAAATCTCGAGATTTCTGGTAGCACGCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175895.3-828s21c1
Sequence:CCGGGGGAGTGGAGTCCCAAACTTTCTCGAGAAAGTTTGGGACTCCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175895
C12orf61 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 61
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-737s1c1
Sequence:CCGGCTACCAGAAATCAGCCCTGAACTCGAGTTCAGGGCTGATTTCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1370s1c1
Sequence:CCGGGACTGTATCTGGCAACCCTATCTCGAGATAGGGTTGCCAGATACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1475s1c1
Sequence:CCGGGAATTGTCTTTGCCCAGACTTCTCGAGAAGTCTGGGCAAAGACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-596s1c1
Sequence:CCGGCGAACCTTAGAGATCACTTAACTCGAGTTAAGTGATCTCTAAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1270s1c1
Sequence:CCGGGAATTTCAGATAACCAGTGTTCTCGAGAACACTGGTTATCTGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1464s1c1
Sequence:CCGGCCTACAACTTAGAATTGTCTTCTCGAGAAGACAATTCTAAGTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163046    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-594s1c1
Sequence:CCGGGACGAACCTTAGAGATCACTTCTCGAGAAGTGATCTCTAAGGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1486s1c1
Sequence:CCGGGCCCAGACTTTGATCCTTCATCTCGAGATGAAGGATCAAAGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175895.3-726s21c1
Sequence:CCGGCGTCAGCGTGCTACCAGAAATCTCGAGATTTCTGGTAGCACGCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175895.3-828s21c1
Sequence:CCGGGGGAGTGGAGTCCCAAACTTTCTCGAGAAAGTTTGGGACTCCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175895
C12orf61 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 61
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-737s1c1
Sequence:CCGGCTACCAGAAATCAGCCCTGAACTCGAGTTCAGGGCTGATTTCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1370s1c1
Sequence:CCGGGACTGTATCTGGCAACCCTATCTCGAGATAGGGTTGCCAGATACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1475s1c1
Sequence:CCGGGAATTGTCTTTGCCCAGACTTCTCGAGAAGTCTGGGCAAAGACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162523    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-596s1c1
Sequence:CCGGCGAACCTTAGAGATCACTTAACTCGAGTTAAGTGATCTCTAAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1270s1c1
Sequence:CCGGGAATTTCAGATAACCAGTGTTCTCGAGAACACTGGTTATCTGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1464s1c1
Sequence:CCGGCCTACAACTTAGAATTGTCTTCTCGAGAAGACAATTCTAAGTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163046    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-594s1c1
Sequence:CCGGGACGAACCTTAGAGATCACTTCTCGAGAAGTGATCTCTAAGGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165334    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175895.2-1486s1c1
Sequence:CCGGGCCCAGACTTTGATCCTTCATCTCGAGATGAAGGATCAAAGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175895.3-726s21c1
Sequence:CCGGCGTCAGCGTGCTACCAGAAATCTCGAGATTTCTGGTAGCACGCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175895.3-828s21c1
Sequence:CCGGGGGAGTGGAGTCCCAAACTTTCTCGAGAAAGTTTGGGACTCCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks