EMAIL THIS PAGE TO A FRIEND

C12orf63

chromosome 12 open reading frame 63

13 Gene Product Result for
Species: Human C12orf63(374467)
UniProtKB ID: Q6ZTY8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302878 ANTI-C12ORF63 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198520 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013001 MISSION® esiRNA esiRNA targeting human C12orf63 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198520 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177997 predicted 2144
2 SASI_Hs01_00177998 predicted 1093
3 SASI_Hs01_00177999 predicted 1699
4 SASI_Hs01_00178000 predicted 1781
5 SASI_Hs01_00178002 predicted 2308
6 SASI_Hs01_00178003 predicted 284
7 SASI_Hs01_00178004 predicted 1084
8 SASI_Hs01_00178005 predicted 2922
9 SASI_Hs01_00178006 predicted 1256
10 SASI_Hs02_00372098 predicted 1248
11 SASI_Hs01_00178001 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198520
C12orf63 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 63
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198520.2-1471s21c1
Sequence:CCGGGAACGTTGCTATGCTCAATATCTCGAGATATTGAGCATAGCAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198520.2-2940s21c1
Sequence:CCGGTCGTTCATCAAACACTAAATACTCGAGTATTTAGTGTTTGATGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-1698s1c1
Sequence:CCGGCCTCAAGATAGAAGTCCTTATCTCGAGATAAGGACTTCTATCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-1342s1c1
Sequence:CCGGGCAGTCATATCAGCAAAGATACTCGAGTATCTTTGCTGATATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-735s1c1
Sequence:CCGGGCTGAGAATACAGAAGTTCAACTCGAGTTGAACTTCTGTATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-122s1c1
Sequence:CCGGCAGACTCTCAATCAGGTTCTACTCGAGTAGAACCTGATTGAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198520.1-808s1c1
Sequence:CCGGGAGAAGATAACTTGCCGAAATCTCGAGATTTCGGCAAGTTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-2476s1c1
Sequence:CCGGGCCCGAGAATATTTCAACATTCTCGAGAATGTTGAAATATTCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198520.1-2151s1c1
Sequence:CCGGGCTAAAGTCGATGTTACTGATCTCGAGATCAGTAACATCGACTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198520.1-1690s1c1
Sequence:CCGGGCAAGAATCCTCAAGATAGAACTCGAGTTCTATCTTGAGGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198520
C12orf63 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 63
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198520.2-1471s21c1
Sequence:CCGGGAACGTTGCTATGCTCAATATCTCGAGATATTGAGCATAGCAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198520.2-2940s21c1
Sequence:CCGGTCGTTCATCAAACACTAAATACTCGAGTATTTAGTGTTTGATGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-1698s1c1
Sequence:CCGGCCTCAAGATAGAAGTCCTTATCTCGAGATAAGGACTTCTATCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-1342s1c1
Sequence:CCGGGCAGTCATATCAGCAAAGATACTCGAGTATCTTTGCTGATATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-735s1c1
Sequence:CCGGGCTGAGAATACAGAAGTTCAACTCGAGTTGAACTTCTGTATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-122s1c1
Sequence:CCGGCAGACTCTCAATCAGGTTCTACTCGAGTAGAACCTGATTGAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198520.1-808s1c1
Sequence:CCGGGAGAAGATAACTTGCCGAAATCTCGAGATTTCGGCAAGTTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-2476s1c1
Sequence:CCGGGCCCGAGAATATTTCAACATTCTCGAGAATGTTGAAATATTCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198520.1-2151s1c1
Sequence:CCGGGCTAAAGTCGATGTTACTGATCTCGAGATCAGTAACATCGACTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198520.1-1690s1c1
Sequence:CCGGGCAAGAATCCTCAAGATAGAACTCGAGTTCTATCTTGAGGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198520
C12orf63 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 63
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198520.2-1471s21c1
Sequence:CCGGGAACGTTGCTATGCTCAATATCTCGAGATATTGAGCATAGCAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198520.2-2940s21c1
Sequence:CCGGTCGTTCATCAAACACTAAATACTCGAGTATTTAGTGTTTGATGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-1698s1c1
Sequence:CCGGCCTCAAGATAGAAGTCCTTATCTCGAGATAAGGACTTCTATCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-1342s1c1
Sequence:CCGGGCAGTCATATCAGCAAAGATACTCGAGTATCTTTGCTGATATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-735s1c1
Sequence:CCGGGCTGAGAATACAGAAGTTCAACTCGAGTTGAACTTCTGTATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-122s1c1
Sequence:CCGGCAGACTCTCAATCAGGTTCTACTCGAGTAGAACCTGATTGAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198520.1-808s1c1
Sequence:CCGGGAGAAGATAACTTGCCGAAATCTCGAGATTTCGGCAAGTTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198520.1-2476s1c1
Sequence:CCGGGCCCGAGAATATTTCAACATTCTCGAGAATGTTGAAATATTCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198520.1-2151s1c1
Sequence:CCGGGCTAAAGTCGATGTTACTGATCTCGAGATCAGTAACATCGACTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198520.1-1690s1c1
Sequence:CCGGGCAAGAATCCTCAAGATAGAACTCGAGTTCTATCTTGAGGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks