EMAIL THIS PAGE TO A FRIEND

C12orf65

chromosome 12 open reading frame 65

39 Gene Product Result for
Synonyms: COXPD7 SPG55
Species: Human C12orf65(91574)
UniProtKB ID: Q9H3J6, Q8WUC6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152269 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152269 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164216 predicted 709
2 SASI_Hs02_00365788 predicted 745
3 SASI_Hs01_00164218 predicted 784
4 SASI_Hs01_00164219 predicted 751
5 SASI_Hs01_00164220 predicted 773
6 SASI_Hs02_00365789 predicted 761
7 SASI_Hs01_00164221 predicted 781
8 SASI_Hs01_00164222 predicted 714
9 SASI_Hs01_00164223 predicted 665
10 SASI_Hs01_00164224 predicted 753
11 SASI_Hs01_00164217 predicted 646
12 SASI_Hs01_00164225 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152269
VALIDATED
C12orf65 MISSION shRNA Bacterial Glycerol Stock
chromosome 12 open reading frame 65
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152269.1-1206s1c1
Sequence:CCGGCGAGTTCCATCACCAGCATTACTCGAGTAATGCTGGTGATGGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152269.1-952s1c1
Sequence:CCGGGAACAGAAAGCTAGCTCGGAACTCGAGTTCCGAGCTAGCTTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152269.1-1099s1c1
Sequence:CCGGGAAGCTACTTAAAGAACTGTGCTCGAGCACAGTTCTTTAAGTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152269.1-906s1c1
Sequence:CCGGCCTCAGGCATCGTTGTAAAGTCTCGAGACTTTACAACGATGCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152269.3-805s21c1
Sequence:CCGGGAAGCTCCCAGGGAATAATGGCTCGAGCCATTATTCCCTGGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-343s21c1
Sequence:CCGGGGGAGAAGCTGACGTTGTTATCTCGAGATAACAACGTCAGCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-374s21c1
Sequence:CCGGAGCTGTCACTCCGGTCCAGATCTCGAGATCTGGACCGGAGTGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-421s21c1
Sequence:CCGGTGCTTTCCTTGGATGAGAATGCTCGAGCATTCTCATCCAAGGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-551s21c1
Sequence:CCGGCCATCAGACAAGATCAGTTGACTCGAGTCAACTGATCTTGTCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152269.3-905s21c1
Sequence:CCGGTAAATGGTGCACTAAACTGTACTCGAGTACAGTTTAGTGCACCATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152269
VALIDATED
C12orf65 MISSION shRNA shRNA Plasmid DNA
chromosome 12 open reading frame 65
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152269.1-1206s1c1
Sequence:CCGGCGAGTTCCATCACCAGCATTACTCGAGTAATGCTGGTGATGGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152269.1-952s1c1
Sequence:CCGGGAACAGAAAGCTAGCTCGGAACTCGAGTTCCGAGCTAGCTTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152269.1-1099s1c1
Sequence:CCGGGAAGCTACTTAAAGAACTGTGCTCGAGCACAGTTCTTTAAGTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152269.1-906s1c1
Sequence:CCGGCCTCAGGCATCGTTGTAAAGTCTCGAGACTTTACAACGATGCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152269.3-805s21c1
Sequence:CCGGGAAGCTCCCAGGGAATAATGGCTCGAGCCATTATTCCCTGGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-343s21c1
Sequence:CCGGGGGAGAAGCTGACGTTGTTATCTCGAGATAACAACGTCAGCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-374s21c1
Sequence:CCGGAGCTGTCACTCCGGTCCAGATCTCGAGATCTGGACCGGAGTGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-421s21c1
Sequence:CCGGTGCTTTCCTTGGATGAGAATGCTCGAGCATTCTCATCCAAGGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-551s21c1
Sequence:CCGGCCATCAGACAAGATCAGTTGACTCGAGTCAACTGATCTTGTCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152269.3-905s21c1
Sequence:CCGGTAAATGGTGCACTAAACTGTACTCGAGTACAGTTTAGTGCACCATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152269
VALIDATED
C12orf65 MISSION shRNA Lentiviral Transduction Particles
chromosome 12 open reading frame 65
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152269.1-1206s1c1
Sequence:CCGGCGAGTTCCATCACCAGCATTACTCGAGTAATGCTGGTGATGGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152269.1-952s1c1
Sequence:CCGGGAACAGAAAGCTAGCTCGGAACTCGAGTTCCGAGCTAGCTTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152269.1-1099s1c1
Sequence:CCGGGAAGCTACTTAAAGAACTGTGCTCGAGCACAGTTCTTTAAGTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152269.1-906s1c1
Sequence:CCGGCCTCAGGCATCGTTGTAAAGTCTCGAGACTTTACAACGATGCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152269.3-805s21c1
Sequence:CCGGGAAGCTCCCAGGGAATAATGGCTCGAGCCATTATTCCCTGGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-343s21c1
Sequence:CCGGGGGAGAAGCTGACGTTGTTATCTCGAGATAACAACGTCAGCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-374s21c1
Sequence:CCGGAGCTGTCACTCCGGTCCAGATCTCGAGATCTGGACCGGAGTGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-421s21c1
Sequence:CCGGTGCTTTCCTTGGATGAGAATGCTCGAGCATTCTCATCCAAGGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152269.3-551s21c1
Sequence:CCGGCCATCAGACAAGATCAGTTGACTCGAGTCAACTGATCTTGTCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152269.3-905s21c1
Sequence:CCGGTAAATGGTGCACTAAACTGTACTCGAGTACAGTTTAGTGCACCATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks